Скорпион андрей характеристика: Страница не найдена (Ошибка 404)

Содержание

значение имени, происхождение, характеристики, гороскоп :: Инфониак

Значение имени

В Андрее сочетаются такие качества как трезвый расчет и расточительность, спокойствие и эмоциональность, серьезность и веселость, при этом важно, в какое время года был рожден носитель данного имени.

Характеристика имени Андрей

В Андрее сочетаются такие качества как трезвый расчет и расточительность, спокойствие и эмоциональность, серьезность и веселость, при этом важно, в какое время года был рожден носитель данного имени.

Осенний Андрей обладает аналитическим складом ума, он пунктуален, дисциплинирован и привык выстраивать свою жизнь по четко составленному плану, в котором нет места случайностям. Неудивительно, что он тяготеет к точным, а также естественным наукам, что впоследствии помогает ему стать успешным предпринимателем.

Зимний Андрей – творческая личность, которая найдет себя на поприще режиссера, актера, певца, поэта или художника. Он справедлив, но при этом мягок, не приемлет лжи и равнодушия. Из-за мягкого характера и принципиальности часто наживает врагов, поскольку яростно отстаивает свои убеждения. В отношениях с девушками зимний Андрей обаятелен, обходителен и романтичен.

Весенний Андрей отличается легкомыслием и беспечным отношением к жизни. Его великодушие никого не оставит равнодушным, поэтому у него много друзей. А вот второй половинке летнего Андрея придется несладко, ведь он жаждет приключений и развлечений, тогда как заботы о содержании семьи его мало интересуют.


Летний Андрей – настоящий весельчак и балагур, которому рады в любой компании, ведь его смешные истории и прекрасное чувство юмора всем поднимают настроение. Благодаря своему легкому характеру и жизнелюбию он пользуется повышенным вниманием у женщин.

Камень – талисман

Камнями-талисманами носителей имени Андрей являются аметист и янтарь.

Аметист

Это камень покоя, мира, духовности и благодати, который способен отогнать плохие мысли, укрепить волю, придать сил духовных и физических.

© alusruvi / pixabay

Еще одним полезным свойством аметиста считается уменьшение тяги к ирреальному. Кроме того, этот камень препятствует негативному воздействию со стороны.

Наши предки наделяли аметист и лечебными свойствами, среди которых:

  • ускорение обмена веществ;

  • исцеление ожогов;

  • успокаивание нервной системы.

Этот камень, покровительствующий воздушным знакам и оправляющийся исключительно в серебро, не рекомендуется носить Львам, Козерогам и Рыбам.

Янтарь

Янтарь – камень творческих людей, которым он дарит вдохновение и веру в будущее. Показано ношение этого камня и тем, кто хочет укрепить свой боевой дух и увеличить физическую силу. Из янтаря изготавливались амулеты, приносящие счастье и удачу.

© vvoevale

Красный янтарь способен нейтрализовать магическое воздействие, предостеречь от порчи и сглаза.

Интересный факт! Янтарь нельзя оправлять в серебро, лучше носить его в меди.

Цвет

Имени Андрей покровительствуют сиреневый, желтый и коричневый цвета (подробнее о значении указанных цветов можно прочитать в статье «Влияние знака зодиака и цвета имени на жизнь человека»).

Число

Счастливое число Андрея – двойка (со значением этого числа можно ознакомиться в статье «Стихии, планеты и числа в жизни человека»).

Планета

Покровительствуют Андрею такие планеты как Уран и Солнце (об их влиянии можно узнать из статьи «Стихии, планеты и числа в жизни человека»).

© hideto111 / Getty Images Pro

Стихия

Стихией имени Андрей является Огонь (подробнее о данной стихии можно узнать из статьи «Стихии, планеты и числа в жизни человека»).

Животное – символ

Животным-символом носителей имени Андрей считается камышовый кот, олицетворяющий мудрость, хитрость, храбрость, мужество и силу духа.

© hamik

Кроме того, это животное всегда символизировало власть, поскольку позволить себе содержать их могли лишь богатые люди.

Зодиак

Наиболее счастливые знаки зодиака для Андрея – Рак и Стрелец (о влиянии этих знаков на судьбу можно прочитать в статье «Влияние знака зодиака и цвета имени на жизнь человека»).

Растение

Растения, покровительствующие Андрею, это анемон и пихта.

Анемон

Этот цветок символизирует одиночество, печаль и страдание.

© Anastasia Collection

Согласно преданию, красное пятно, имеющееся на этом цветке, является олицетворением крови Иисуса, тогда как тройной лист – это символ Троицы.

Пихта

Это красивое дерево с растущими вверх шишками – символ гордости, терпения, настойчивости и одиночества.

© Brett Sayles / Pexels

Пихта олицетворяет людей, отказавшихся от всех низменных желаний, а потому заслуживших жизнь на Небесах.

Металл

Металлом, приносящим удачу Андрею, является серебро, способное изгонять злых духов и оберегать от магического воздействия. Также этот металл символизирует чистоту, целомудрие, надежду, мудрость и красноречие.

© Thomas Northcut / Photo Images

Серебро обладает высокой степенью бактерицидности, благодаря чему предохраняет от различных инфекционных заболеваний.

Интересный факт! Серебро помогает открыть «третий глаз», тем самым способствуя проявлению сверхспособностей человека.

Благоприятный день

Понедельник.

Неблагоприятный день

Среда.

Время года

Лето.

Происхождение имени Андрей

Перевод имени

С древнегреческого имя Андрей переводится как «мужественный», «сильный», «храбрый».

История имени

Имя Андрей имеет древнегреческие корни, а именно происходит от слова «андрос», что обозначает «мужчина».

На Руси это имя стало популярным после принятия христианства. Сегодня имя Андрей, попавшее к нам из Византии, по праву считается традиционным русским именем.

Формы (аналоги) имени

Распространенными формами имени Андрей являются: Андрюша, Андрейка, Андрюшенька, Андрон, Дрон.

Легенда об имени Андрей

Андрей, являющийся братом Петра и учеником Иоанна Крестителя, был первым, кого Иисус призвал в апостолы (поэтому и называют Андрея «Первозванным»).

© Kamchatka

Согласно преданию, он обращал в веру Христову народы, проживавшие на территории Балкан и Причерноморья. Андрей Первозванный был схвачен и распят по приказу римского магистрата в греческом городе Патры, при этом распяли его на кресте, который имел форму буквы X.

Надо сказать, что в России этот апостол пользовался особым уважением и любовью, о чем свидетельствует тот факт, что упоминание о нем присутствует в «Повести временных лет». Так, апостол Андрей доходил со своими проповедями до тех мест, где в будущем были основаны такие города как Киев и Новгород. Именно он некогда благословил эти места.

Кроме того, во времена Киевской Руси Андрей Первозванный считался покровителем русской государственности, тогда как в императорской России почитался в качестве патрона русского военно-морского флота (Петр I своим указом учредил Андреевский флаг с синим крестом и Андреевский орден).

Тайна имени Андрей

Покровители имени

  • Апостол Андрей Первозванный.

  • Князь Андрей Боголюбский, основавший Боголюбский монастырь.

  • Мученик Андрей Стратилат.

  • Святой Андрей Месукевийский.

  • Князь Андрей Вологодский.

  • Князь Андрей Смоленский.

  • Пресвитер и священномученик Андрей Ефесский.

  • Блаженный Андрей Константинопольский.

  • Архиепископ Андрей Критский.

  • Святой мученик Андрей Лампсакский.

  • Преподобный Андрей Оксиринфский (или Египетский).

  • Преподобный иконописец Андрей Рублев (был учеником преподобного Сергия Радонежского).

  • Юродивый Андрей Тотемский.

  • Мученик Андрей Сиракузский.

  • Преподобный Андрей Фиваидский.

  • Мученик Андрей Хиосский.

День ангела (именины)

Январь: 26 и 27 числа.

Февраль: 17 и 21 числа.

Март: 7 число.

Апрель: 28 число.

Май: 31 число.

Июнь: 3, 5, 11, 15, 23, 25 и 26 числа.

Июль: 3, 13, 17, 19, 22 и 25 числа.

Август: 5 и 17 числа.

Сентябрь: 1, 16, 19, 20, 23 и 28 числа.

Октябрь: 3, 4, 5, 6, 7, 15, 23, 30 и 31 числа.

Ноябрь: 9 и 11 числа.

Декабрь: 8, 10, 11, 13, 15, 16 и 23 числа.

Известные люди

Знаменитые актеры по имени Андрей:

  • Андрей Миронов;

  • Андрей Краско;

  • Андрей Леонов;

  • Андрей Панин;

  • Андрей Мерзликин.

Знаменитые певцы и музыканты по имени Андрей:

  • Андрей Макаревич;

  • Андрей Данилко;

  • Андрей Губин.

Андрей Аршавин – капитан сборной России по футболу.

Андрей Шевченко – украинский футболист.

Андрей Вознесенский – русский публицист и поэт.

Андрей Туполев – советский авиаконструктор, разработавший более 100 типов самолетов.

Андрей Сахаров – советский физик и теоретик, являющийся одним из создателей первой в СССР водородной бомбы.

Андрей Тарковский – советский режиссер и сценарист.

Андрей Васнецов – российский художник.

Значение имени Андрей

Для ребенка

Маленький Андрей – настоящий мечтатель, который грезит невероятными приключениями, его энергичности можно только позавидовать. Но интересуют Андрюшу не только активные игры: он с удовольствием соберет конструктор или починит поломанную игрушку.

© Konstantin Aksenov

Андрей, несмотря на свою мечтательность, хитер и рассудителен, у него на все есть своя точка зрения, которую он будет отстаивать и перед родителями, и перед сверстниками. В детстве непослушный и невозмутимый Андрюша плохо ладит с девочками (даже со своей сестрой он не может найти общий язык, тогда как с братом общается с удовольствием).

Усердие и старательность Андрея проявляются как на бытовом уровне (он умеет не только чинить, но и самостоятельно изготавливать удивительные игрушки из подручных средств), так и в школе (его можно без зазрения совести назвать преуспевающим учеником).

Чего не отнять у маленького Андрея – так это обостренного чувства справедливости (мальчик всегда защитит слабого и поможет тем, кому нужна его поддержка).

Отрицательными качествами мальчика можно назвать надменность, капризность и чрезмерную властность.

Для подростка

В подростковом возрасте Андрей уделяет особое внимание своему физическому воспитанию, поэтому посещает спортивные секции и школы, добиваясь больших успехов в выбранном виде спорта.

Андрей-подросток – это личность противоречивая и непостоянная: так, сегодня он может пылко признаваться одной девушке в любви, а завтра с легкостью пригласит на свидание другую.

Андрей мастерски умеет скрывать свои эмоции, поэтому остается для многих человеком-загадкой. Он обладает ясным умом, изобретательностью, уравновешенностью и эгоистичностью. Его общительность, умение находить общий язык, высокая самооценка и уверенность в себе помогают ему завоевать уважение у сверстников. Он весел, щедр и добродушен, поэтому зачастую выступает в роли «души компании».

Носители имени Андрей – прекрасные психологи, поэтому даже не думайте обмануть или обхитрить их. Если Андрей заподозрит ложь, то в его лице Вы наживете непримиримого врага, при этом его гордость и тщеславие не позволят первому пойти на сближение.

Для мужчины

Перейдя рубеж подросткового возраста, Андрей не бросает занятия спортом, ведь для него очень важно то, как он выглядит. Не против он сыграть с достойным соперником в шахматы или шашки.

© Dean Drobot

Взрослый Андрей мужественен и обаятелен, он быстро находит общий язык с окружающими, поэтому в любой компании ему рады (особенно если учесть тот факт, что Андрей обладает поистине искрометным чувством юмора).

За добросовестность, терпение, аккуратность, честность и ответственность на работе его уважают и коллеги, и начальство (и это несмотря на то, что Андрей может жестко отстаивать свое мнение). Немаловажно и то, что он умеет признавать свои ошибки, что ценит его окружение.

Андрей – это философ, который любит вести размеренные разговоры о смысле бытия и секретах мироздания. Спокойствие и стабильность – вот к чему стремится Андрей, тогда как рискованные предприятия старается обходить стороной.

Но есть у Андрея и недостатки, например, перепады настроения, что чревато приступами уныния, которых никто не заметит (Андрей, как истинный мужчина, все переживания оставляет при себе). В трудных ситуациях он может проявить как целеустремленность и настойчивость, так и малодушие и нерешительность (все зависит от настроения и мотивации Андрея). Окрыленный успехом Андрей может стать тщеславным, заносчивым и самоуверенным, что может оттолкнуть от него людей.

Описание имени Андрей

Нравственность

Андрея можно назвать высоконравственным человеком, при этом он не только сам старается соответствовать высоким нравственным принципам, а и требует этого от тех людей, которые его окружают. Он внимательный и ласковый сын, преданный друг, верный муж и ответственный работник.

Здоровье

Андрей – обладатель крепкого здоровья, что не в последнюю очередь связано с тем, что много времени он посвящает своему физическому воспитанию. Если и болеет, то преимущественно простудой.

© Syda Productions

А вот своему душевному состоянию Андрею следует уделить особое внимание, поскольку стрессы и депрессии могут стать причиной развития многих других заболеваний. Лучшее лекарство для Андрея от хандры – это природный оптимизм и забота близких людей, которые должны вернуть ему веру в себя.

Любовь

Непостоянство Андрея проявляется в личной жизни: несмотря на свою нравственность, до момента вступления в брак он не отличается постоянством, обосновывая это тем, что должен выбрать самую лучшую женщину, которой посвятит всю свою жизнь. Такое поведение приводит к тому, что представительницы прекрасной половины человечества обижаются на Андрея.

Андрей крайне избирателен в выборе своей возлюбленной, которая просто обязана быть красивой, эффектной, умной, заботливой и эмоциональной. А вот внутренний мир любимой женщины интересует Андрея мало, поскольку основная ее задача – боготворить своего суженого, создавать уют и комфорт. Он всегда нежен и внимателен, однако чаще всего им руководит не чувство любви, а желание выглядеть в глазах женщины рыцарем и благодетелем.

Брак

В жены Андрей выбирает красивую и эффектную женщину (зачастую именно внешность становится решающим фактором при выборе супруги), которая обязательно должна нравиться его знакомым и друзьям (жена становится некой визитной карточкой Андрея). При этом нельзя не сказать о том, что Андрей все же женится по любви, но если его жена не будет соответствовать его высоким «стандартам», то он может увлечься другой женщиной. Интересно то, что измены свои он тщательно скрывает, продолжая играть роль примерного семьянина (развод для Андрея равносилен признанию его несостоятельности как настоящего мужчины).

Семейные отношения

Андрея тяжело назвать хозяйственным человеком (для этого у него есть жена, на плечи которой ложатся все бытовые проблемы), при этом он считает себя полноправным главой семейства, основная задача которого заключается в обеспечении семьи материальными благами. Поэтому рядом с Андреем уживется лишь заботливая и нежная женщина, готовая забыть о своей карьере и посвятить свою жизнь безраздельно своей семье.

© Robert Kneschke

Эгоистичный и ревнивый Андрей требует к себе максимум внимания, поэтому вполне может ревновать жену к ребенку.

Сексуальность

В сексуальной жизни Андрей крайне восприимчив и чувствителен, он любит лесть, комплименты, а также повышенное внимание. Женщинам он готов дарить нежность и страсть, но лишь при условии, что они будут платить ему сторицей.

Интересно то, что такие понятия как любовь и секс для Андрея неделимы, поэтому он не будет тратить ни своих душевных, ни физических сил на женщину, к которой не испытывает хотя бы чувства влюбленности. Дело в том, что для Андрея даже любовь является некой формой самоутверждения в сексуальной сфере и признанием его недюжинных способностей.

Андрей может всецело отдаваться сексуальным утехам, а может захотеть отдохнуть от активной интимной жизни. Поэтому ему нужна терпеливая и понимающая женщина, которая сможет мириться с такими перепадами настроения Андрея.

В своей партнерше он не потерпит грубости и отсутствия женственности.

Ум (интеллект)

Андрей обладает прекрасно развитым интеллектом, благодаря чему способен быстро выстраивать логические цепочки, что в сочетании с его аналитическим мышлением помогает добиться больших высот на любом поприще.

Профессия

Высокая самооценка Андрея и его уверенность в себе, несомненно, способствуют карьерному росту. Если же добавить к этим качествам добросовестность и исполнительность, то становится понятно, почему он пользуется уважением у начальства. С подчиненными и коллегами Андрей тоже отлично ладит, а все благодаря обаянию, чувству юмора и умению подобрать к каждому человеку нужный ключик.

© StefanDahl

Артистичность Андрея и его стремление быть всегда в центре внимания найдут выход в творческих профессиях (из Андрея получится хороший актер, композитор, художник, певец, писатель или режиссер). Отзывчивость и добродушие носителей этого имени как нельзя кстати придутся в профессии спасателя, пожарного или врача.

Но Андрей – не альтруист, а потому профессию будет выбирать такую, которая сможет принести ему финансовую стабильность и независимость. Немаловажным фактором для него является и престижность выбранного поприща.

Бизнес

Практичность Андрея и его рациональность способствуют тому, что он добивается больших успехов в предпринимательской деятельности. Он не любит рисковать, а все свои действия продумывает на несколько ходов вперед, поэтому заранее знает исход того или иного предприятия, той или иной сделки. При этом свой бизнес он ведет честно, за что его уважают партнеры.

Увлечения

Увлечения Андрея разносторонние и порой несовместимые. Он может заниматься боксом или единоборствами, а может играть в шахматы, может увлекаться футболом и конструированием моделей самолетов.

Тип характера

Чаще всего носители имени Андрей обладают холерическим типом мышления (подробнее о холериках можно узнать из статьи «Стихии, планеты и числа в жизни человека»).

Психика

На первый взгляд Андрей производит впечатление оптимистичного, открытого, веселого, простого и жизнерадостного человека, но не стоит доверять первому впечатлению. На самом деле Андрей редко открывает свою душу людям, поскольку очень тяжело переживает обиды и предательства.

© yacobchuk / Getty Images Pro

Его нельзя открыто критиковать и сомневаться в его способностях. Стимулировать его лучше похвалой и поощрением.

По отношению к своим врагам Андрей непримирим, поэтому лучше сто раз подумать перед тем, как вступать с ним в конфронтацию.

Интуиция

Андрей обладает развитой интуицией, которая помогает ему не только выстраивать личные отношения, но и удачно вести бизнес. Надо сказать, что Андрей, несмотря на свою прагматичность, часто прислушивается к своей интуиции, тем более что она практически никогда не подводит.

Гороскоп имени Андрей

Андрей – Овен

Это достаточно неуравновешенная личность, подверженная частой и резкой смене настроения. Андрей-Овен может проявлять агрессию по отношению к окружающим, но такое поведение является лишь защитной реакцией, за которой скрываются ранимость и обидчивость. Андрею, рожденному под знаком Овна, нелегко найти общий язык с противоположным полом.

Андрей – Телец

Неуверенность в себе и болезненное восприятие критики в свой адрес способствуют тому, что Андрей-Телец часто замыкается и отгораживается от социума. У него мало друзей, которые способны принять его таким, какой он есть.

© stevanovicigor / Getty Images

Для Андрея-Тельца самое важное – это семья, в которой он должен чувствовать заботу и поддержку.

Андрей – Близнецы

Это человек с очень развитым воображением, поэтому ему легко найти себя в любой сфере и сойтись с любыми людьми. Недостаток его состоит в том, что он слишком зависит от мнения окружающих, что мешает ему проявить себя и свои возможности в полной мере. Андрей-Близнецы – свободолюбивая натура, но своей избраннице он свободу ограничивает.

Андрей – Рак

Острый ум и прекрасная память помогают Андрею-Раку достичь невероятных успехов в работе. Он твердой поступью идет к намеченной цели, и никакие преграды не в силах его остановить. Его чувство собственничества распространяется не только на возлюбленную, но и на друзей.

Андрей – Лев

Благородство, честолюбие и тщеславие – вот основные характеристики Андрея-Льва, привыкшего всегда и во всем быть лучшим. Эти качества помогают ему сделать прекрасную карьеру. Он нравится женщинам, но, выбрав ту единственную, не станет ей изменять, ведь семья у него стоит на первом месте.

Андрей – Дева

Это неуверенный в себе человек, который ко всему относится недоверчиво и настороженно.

© yuelan / Getty Images

Андрей-Дева испытывает внутренний страх перед принятием серьезных решений, поэтому ему нужна женщина, которая сможет подарить ему максимум тепла и любви, поддержит во всех его начинаниях.

Андрей – Весы

Это серьезная, прагматичная и обстоятельная натура, для которой важны морально-этические аспекты жизни. Андрей-Весы – преданный муж, любящий отец, добросовестный работник. Его слова никогда не расходятся с делом.

Андрей – Скорпион

Сентиментальный мечтатель, последний романтик – так можно охарактеризовать Андрея-Скорпиона, который все принимает слишком близко к сердцу. Ему свойственно проявлять и такие качества как капризность, упрямство и агрессию, поэтому его второй половинке надо набраться терпения и понимания.

Андрей – Стрелец

Это покоритель женских сердец, в жизни которого одно любовное приключение сменяется другим, при этом всех своих женщин Андрей-Стрелец искренне любит, но и остывают его пылкие чувства очень быстро.

© Olga_Kruglova / Getty Images

Лишь оригинальная и необычная женщина может удержать возле себя такого казанову.

Андрей – Козерог

Это трудолюбивый, упорный и крайне сознательный человек, который готов трудиться 24 часа в сутки ради достижения своей цели и благосостояния своей семьи.

В жены Андрей-Козерог выбирает хозяйственную и домашнюю женщину, которая сможет стать для него настоящим тылом.

Андрей – Водолей

Это мягкий, добродушный и чувственный человек с богатым воображением, который склонен идеализировать людей (поэтому часто Андрей-Водолей разочаровывается в людях, которые в итоге не отвечают его высоким идеалам). Крепкий союз возможен лишь с сильной и уверенной в себе женщиной, знающей себе цену.

Андрей – Рыбы

Жизненные трудности могут привести робкого, уязвимого и впечатлительного Андрея-Рыбу к нервным срывам. Он с пониманием относится к окружающим людям, которым всегда готов помочь. Его любят дети и жена, которых он просто боготворит.

Совместимость имени Андрей с женскими именами

Андрей и Ольга

Это творческий союз, который строится на общих интересах, причем эти интересы могут быть как личными, так и деловыми. Но следует остерегаться определенной легкомысленности в отношениях, которая может поставить под сомнение доверие между партнерами Андреем и Ольгой.

Андрей и Анна

Это очень интересная пара, которая может показаться странной, ведь Анна и Андрей далеки от реалий современного мира, в котором правят деньги и власть.

© Jupiterimages / Photo Images

Они сосредоточены друг на друге и на саморазвитии, но все же забывать о действительности не стоит, иначе отношения не сложатся.

Андрей и Елена

И Андрей, и Елена не приемлют общепринятых норм, особенно если они не соответствуют их идеалам. Поэтому данный тандем в обществе часто не воспринимается всерьез, но пару это нисколько не смущает, ведь они живут своей обособленной жизнью, в которой им хорошо вместе.

Андрей и Юлия

В этой паре не знают, что такое скука или тоска, ведь они оптимистично смотрят в будущее, строя общие планы. Их манят новые вершины и горизонты, которые они осваивают и покоряют вместе, тем самым наполняя свои отношения новой энергией.

Юлия — значение имени, происхождение, характеристики, гороскоп

Андрей и Анастасия

Этот крепкий союз основан на доверии, почитании традиций, трудолюбии и целеустремленности обоих партнеров. Любовь между Андреем и Анастасией – это симбиоз нежности, дружбы и доверия. А вот страсти в этих отношениях не хватает, что со временем может негативно сказаться на интимной стороне жизни.

Андрей и Татьяна

Дух приключений объединяет Андрея и Татьяну, их манят перемены и новые открытия. Несомненно, такой авантюризм не даст паре заскучать, но отсутствие стабильности может негативно отразиться на семейной жизни, особенно, когда у пары появятся дети.

Андрей и Екатерина

Принципиальность, стремление к лидерству и властность как объединяют партнеров (если Андрей и Екатерина будут вести совместный бизнес, то успех им гарантирован), так и разъединяют (часто партнеры начинают борьбу за власть в семье).

© Joshua Resnick

Только терпение и понимание помогут сохранить этот союз.

Андрей и Наталья

Это далеко не гармоничный и не легкий брак, в котором женщина живет эмоциями, а мужчина – трезвым рассудком. Наталье хочется больше свободы, тогда как эгоистичный Андрей не готов идти на уступки своей возлюбленной.

Андрей и Ирина

Это прочный союз, в котором царят взаимопонимание, поддержка, любовь и абсолютное доверие. Ирина не стремится брать на себя роль главы семейства, напротив, она с удовольствием подчинит свою жизнь интересам семьи. Андрей любит и ценит свою супругу.

Андрей и Мария

В этой паре оба партнера умеют радоваться жизни, при этом свои силы они предпочитают тратить на достижимые цели, а не на иллюзорные мечты.

Андрей и Мария предпочитают не ссориться по мелочам, а решать все проблемы за столом переговоров, что помогает им сохранить нежные чувства.

Андрей и Светлана

Это очень благополучный союз, в котором удача сопутствует Андрею и Светлане во всем. Любовь, слава, богатство являются составляющими такого брака (главное – научиться не только получать от судьбы дары, а и отдавать их часть тем, кто в этом нуждается).

Андрей и Марина

Андрей и Марина – инициативные и активные люди, которые постоянно пытаются привнести в совместную жизнь что-то новое и интересное, дабы быт не разрушил тех нежных и пылких чувств, на которых и основывается их брак.

© Sergey Nivens

Неудивительно, что их отношения – пример для подражания.

Андрей и Кристина

В этом тандеме Кристине отведена роль оратора, а Андрею – слушателя, при этом обоим такая позиция абсолютно подходит. Они не ссорятся и не конфликтуют, поскольку Андрей снисходительно относится к проявлению лидерства своей избранницы.

Андрей и Виктория

Несмотря на то, что союз между Андреем и Викторией может быть продолжительным, прочным его назвать нельзя. Когда страсть проходит, оба партнера живут по принципу «стерпится — слюбится», вместе их удерживают совместный быт и дети.

Андрей и Ксения

Такие отношения основываются на страсти и яркости, но независимость и свободолюбие обоих партнеров часто приводят к ссорам, в которых истина не рождается, а, напротив, теряется. Если Андрей и Ксения не научатся уступать друг другу, их брак обречен.

Андрей и Любовь

Схожесть характеров Андрея и Любы помогает им лучше понять друг друга. Они ценят свои отношения, к которым относятся очень трепетно. Их рациональность и практичность помогают сохранить отношения там, где более эмоциональная пара не смогла бы этого сделать.

Андрей и Яна

И для Андрея, и для Яны брак – ответственный шаг, к которому они идут не один год, проверяя друг друга в различных ситуациях.

© .shock

Поэтому союз их зачастую очень прочен, поскольку партнеры прекрасно знают сильные и слабые стороны друг друга и умеют с ними мириться.

Андрей и Надежда

В этой паре партнеры всецело концентрируются друг на друге и на своих отношениях, которые они выстраивают медленно, но уверенно. Им не свойственна импульсивность и порывистость, что благоприятно отражается на их совместной жизни, в которой конфликты решаются на стадии возникновения.

Надежда — значение имени, происхождение, характеристики, гороскоп

Андрей и Алина

Андрей любит Алину и боготворит ее за женственность и нежность. Алина ценит в своем партнере заботу и умение отстаивать свои интересы. Но карьерист Андрей может потерять семью, если не будет уделять ей должного внимания.

Андрей и Диана

Такие независимые индивидуальности как Андрей и Диана могут создать прекрасный партнерский тандем, тогда как в семейной жизни их амбиции и бескомпромиссность могут помешать построению крепких отношений.

Андрей и Евгения

Это очень прочный союз, в котором партнеры стараются удивлять друг друга, дарить новые эмоции, подпитывающие чувства. Андрей и Евгения любят путешествовать, причем рождение детей не мешает им странствовать. Это активная семья, в которой редко случаются конфликты и недопонимание.

Андрей и Дарья

Эту пару можно назвать идеальной, ведь цель обоих – создать крепкую семью, в которой царят гармония и понимание.

© Minerva Studio

Андрей и Дарья не борются за лидерство, предпочитая равноправие в отношениях.

Андрей и Олеся

Преданность, любовь, страсть – вот основа отношений Андрея и Олеси. Они умеют находить новые краски в обыденных вещах, что помогает им каждый день открывать новые грани друг друга.

Андрей и Алена

Это гармоничные отношения, в которых сексуальной жизни отводится одно из ведущих значений. При этом страсть между Андреем и Аленой не только не остывают, а, напротив, воспламеняются. Главное в этой паре – не допустить войны межличностных интересов.

Андрей и Маргарита

Маргарита любит находиться в центре внимания, она эффектна и красива, что не только манит Андрея, но и постоянно поддерживает его интерес к своей партнерше. И здесь важно, чтобы Маргарита не заигралась с чувствами Андрея.

Андрей и Александра

В паре Александры и Андрея нет места бурной страсти, поэтому и эмоциональных выяснений отношений между ними практически не бывает.

В этом союзе царят разумный подход и практичность, но и нежности в них тоже есть место.

Андрей и Людмила

Это очень сложные отношения, в которых на первое место выходит не любовь, а упрямство партнеров, которое проявляется и в быту, и в семейной жизни, и в интимных отношениях.

© Comstock / Photo Images

Если Андрей и Людмила смогут побороть это качество, то союз их будет ярким и длительным.

Андрей и Галина

Новизна и постоянное движение – вот основа союза между Андреем и Галиной, которые любят общение, приключения, перемены. Не достает этой паре лишь стабильности, а это немаловажно для настоящей сплоченной семьи.

Андрей и Полина

В этой паре нет места эгоизму, ведь Андрей и Полина строят свой союз на любви, нежности и заботе, что помогает им преодолевать все трудности, встающие на их пути. Поставленных целей они добиваются вместе, поддерживая друг друга в любых начинаниях.

Андрей и Карина

Эти отношения больше напоминают взаимовыгодное партнерство, чем брак в традиционном понимании. Но от этого союз Андрея и Карины не становится менее прочным и продуктивным, но при условии, что обоим подходит подобный формат отношений, в которых нет пылкой страсти.

Андрей и Инна

В этом союзе есть все: любовь, нежность, масса положительных эмоций. Нет лишь стабильности, которая просто необходима для создания крепкой семьи. Поэтому брак Андрея и Инны редко длится долго.

Андрей и Валерия

Авантюризм и желание перемен руководят этой парой, для развития отношений в которой жизненно необходимы эмоциональные всплески.

© Comstock Images / Photo Images

Новые знакомства, новые места, новые впечатления способны вновь и вновь воспламенять чувства Андрея и Валерии.

Андрей и Алла

Это союз, в котором нет места обыденности, причем часто это отрицательно сказывается на взаимоотношениях Андрея и Аллы. Они умеют страстно любить и пылко ненавидеть, быть нежными и агрессивными. Чрезмерная эмоциональность партнеров приводит к тому, что в конечном итоге пара распадается.

Андрей и Елизавета

Эти непохожие люди прекрасно чувствуют себя в обществе друг друга, но разные жизненные ориентиры могут стать для Андрея и Елизаветы непреодолимым препятствием на пути к счастливой семейной жизни.

Андрей и Вероника

Это очень перспективный союз, объединяющий двух жизнелюбивых и энергичных людей, которые могут превратить свою жизнь в настоящий праздник. К тому же Андрей и Вероника – прекрасные любовники, что немаловажно в семейной жизни.

Андрей и Валентина

Если в паре Андрея и Валентины присутствует любовь, то союз их будет крепким и долгим, в противном случае отношения может разрушить измена партнера, для которого такие понятия как секс и любовь неразрывно связаны.

Андрей и Лилия

Эти двое обладают схожими характерами, что может как сближать их, так и отдалять. Все зависит от способности понимать друг друга, идти на уступки и смотреть в одну сторону. В целом Андрею и Лилии есть чему поучиться друг у друга.

Андрей и Лариса

Это страстный союз, в котором Андрею и Ларисе комфортно не только в интимной жизни, а и в быту.

© Comstock / Photo Images

Эмоциональная Лариса умеет поддержать и приободрить рассудительного Андрея, к тому же оба они готовы идти на компромиссы.

Андрей и Тамара

Серьезной и требовательной Тамаре комфортно с весельчаком Андреем, который способен превратить жизнь своей избранницы в настоящее приключение. И здесь важно, чтобы Тамара научилась более легко относиться к жизни, иначе Андрею наскучит монотонная семейная жизнь.

Андрей и Антонина

Независимые Андрей и Тоня не спешат вступать в брак, и чем больше они оттягивают этот момент, тем меньше у них шансов на создание семьи. В целом свободолюбие обоих партнеров не располагает к крепкому союзу.

Андрей и Ангелина

Это союз людей, которые хотят получать от жизни все и сразу, их жизнь должна напоминать бесконечный праздник, при этом возвращение к реалиям нагоняет на них тоску. Отсутствие романтики и новизны могут привести к разрыву отношений между Андреем и Ангелиной.

Значние имени Андрей — характер, совместимость, судьба

Значение имени Андрей / ua.depositphotos.com/

Православная церковь отмечает именины Андрея 39 раз в году. В декабре чтят святых 7 раз.

Кто отмечает свои именины в последний месяц года, читайте в нашем материале: День ангела в декабре по церковному календарю: именинники месяца.

Имя Андрей: значение

Имя древнегреческого происхождения от слова «андрейос». Оно означает «мужественный», «храбрый». Согласно второй версии, имя происходит от «андрос» — «мужчина», «муж».

Уменьшительно-ласкательные версии имени: Андрюша, Андрюха, Андрейка, Андрюня.

Имя Андрей на разных языках мира:

  • белорусский – Андрэй;
  • польский – Анджей;
  • итальянский – Андреа;
  • болгарский – Андро, Андрешко;
  • немецкий – Андреас;
  • финский – Анти;
  • французский – Андре.

Имя Андрей в истории

Апостол Андрей Первозванный – один из самых известных личностей в истории. Первозванным его называют из-за того, что он был призван Иисусом Христом, как первый из апостолов. После распятия Христа он стал свидетелем его Воскресения и Вознесения. После крестной смерти Христа, апостол проповедовал его учение на землях Вифинии, Фракии, Македонии, Эллады и Скифии. Наделенный даром исцелять, он воскрешал детей после смерти. Он был распят на кресте в Патрах в 67 году.

Самые известные мужчины с именем Андрей:

  • Андрей Кузьменко – Кузьма Скрябин, культовый певец Украины;
  • Андрей Туполев – советский авиаконструктор;
  • Андрей Тарковский – кинорежиссер;
  • Андрей Данилко – украинский шоумен, музыкант – «Верка Сердючка»;
  • Андрей Миронов – советский актер;
  • Андрей Макаревич – лидер рок-группы группы «Машина времени».

Имя Андрей: характер, судьба, совместимость

Обаятельность, ответственность, аккуратность, мужественность, коммуникабельность, трудолюбие и целеустремленность – набор положительных качеств, которые проявляются в характере Андрея уже с самых ранних лет. Однако есть и темные стороны личности. Андреям очень сложно остановиться на чем-то одном, они постоянно движутся от цели к цели, не доводя начатое до конца.

Судьба имени Андрей в отношениях весьма неоднозначна. Он будет долго колебаться с выбором избранницы, и существует вероятность того, что Андрюша так и останется одиноким.

Женятся Андреи исключительно по любви – другого им не дано. Зачастую их браки оказываются крепкими и счастливыми. Он заботливый муж и часто балует свою жену приятными знаками внимания. Однако когда Андрей заскучает в лодке семейного быта, он пойдет искать любовных приключений.

Андрей добрый и чуткий папа, но не слишком ответственный. Он выслушает и поддержит своего ребенка. Очень часто именно из-за детей Андрей так и не решается на развод.

Лучший союз у Андрея с Ксенией, Владиславой, Тамилой, Диной, Яной, Алисой.

Крепкий и счастливый брак возможен с Татьяной, Ладой, Никой, Нонной.

Не стоит пробовать с Анной, Розой, Агатой.

Астрология имени Андрей

  • Знак Зодиака – Скорпион.
  • Планета-покровитель – Луна.
  • Счастливый день – суббота.
  • Пора года – осень.
  • Цвет – сиреневый.
  • Талисман – клен, камень – аметист.

Андрей — значение имени, его судьба и характер. Значение имени андрей, происхождение, характер и судьба имени андрей

Каждое имя имеет уникальную энергетику и дарит своему хозяину удачу. На поиски этой удачи может уйти много лет. Но зная, какова тайна имени Андрей, можно прийти к победам гораздо быстрее, задействовав лучшие свои стороны.

Значение и происхождение имени

Это греческое имя, которое в переводе означает «мужественный». С развитием христианства оно стало частью как православной, так и католической культуры. Имя Андрей — это исконно русский вариант, западной альтернативой которому является Андреас или Эндрю.

Это имя распространено по всему миру, поэтому его смело можно назвать одним из самых популярных. Любопытно, что на протяжении всей истории имя Андрей отличалось стабильностью, особенно в православном и славянском мире — им называли и называют детей очень часто.

Судьба и характер

Андреи невероятно трудолюбивы. Их прыти и заинтересованности может позавидовать кто угодно. Наиболее часто они становятся программистами, инженерами и механиками, хотя нередко встречаются среди них успешные бизнесмены, актеры и художники. Все дело в их трудолюбии и настойчивости, ведь если цель поставлена, Андрей вряд ли отступит.

При этом мужчинам, которые названы этим именем, иногда свойственна неуверенность в своих силах. Андрей всегда старается сделать свою жизнь лучше изо всех сил, причем ему это удается, но он частенько не замечает этого. Он может думать, что у него все намного хуже, чем у остальных, хотя это абсолютно не так.

Хобби и предпочтения Андрея отличаются от обычных, поскольку его притягивает все нестандартное, яркое и интересное. Нельзя сказать, что он не любит деньги, потому что представители этого имени весьма расчетливы. Андрей стремится показать всем, на что он способен, никогда не упустит возможности похвастаться и любит, когда ему завидуют, хоть и не показывает эту черту своего характера.

Связывать с Андреем судьбу бывает непросто, поскольку он очень «медленно» прощает, семейные ценности для него не стоят в приоритете, а сам он довольно эгоистичен. Порой он требует больше, чем делает или готов делать сам. Семья для него — это не что-то высокое и сокровенное, а нечто само собой разумеющееся. Именно поэтому Андрей часто разводится и имеет несколько детей от разных браков. Только похожая на него супруга может остановить череду разводов и стать для него единственной.

Андрей непредсказуем, для него характерно болезненное самолюбие, поэтому даже друзьям бывает с ним непросто. Андрей может спросить совета у близких людей, но все равно поступит по-своему. Даже жизнь редко учит его чему-то, ведь он может наступать на одни и те же грабли бесконечное число раз.

Чаще всего к этому имени не применяют сокращений, называя всех Андреев Андреями. Это довольно редкий случай, когда люди предпочитают не сокращать имя. Короткие формы, такие как Дрон, Дрю и Энди, имеют противоположную энергетику и очень отличаются по произношению и восприятию от Андрея.

Если все же в отношении Андрея используют сокращения, то это говорит о том, что человек этот менее скрытный. Те, кто любит, когда их называют Дрон или Дрю, еще более неосмотрительны, хотя и относятся к жизни проще серьезного Андрея.

Значение имени Андрей для ребенка: подбираем имя детям

Все имена по алфавиту:

День пройдет куда удачнее, если запастись позитивным настроем и подсказками астрологов. В лунном календаре вы…

Формы имени Андрей

Часто встречаемые варианты имени: Андрейка, Андря, Андрюха, Андрюша, Андрюшка. Синонимы имени Андрей. Андреа, Андрес, Онджей, Андра, Антеро, Андре, Эндрю, Ондрей, Андреас. Краткая форма имени Андрей. Андрейка, Андрюха, Андрюша, Андрюня, Андря, Анди, Дрю, Энди, Андра, Данд, Дрео.

Имя Андрей на разных языках

Рассмотрим написание и звучание имени на китайском, японском и других языках: Китайский (как написать иероглифами): 安德魯 (Āndélǔ). Японский: アンドルー(Andorū). Панджаби: ਅੰਦ੍ਰਿਯਾਸ (Adriyāsa). Хинди: एंड्रयू (Ēṇḍrayū). Украинский: Андрій. Непали: अन्द्रियास (Andriyāsa). Английский: Andrew (Andrew).

Происхождение имени Андрей

Планета
— Уран.

Цвет
Андрея
— сиреневый.

Благоприятное
дерево
— пихта.

Заветное
растение
— анемон.

Покровитель
имени
— камышовый кот.

Камень
талисман
— аметист.

Нумерология имени Андрей

Мы не того мужчиною зовем,

Кто яростью сравнится со слоном.

Кто в сильном гневе чепухи не мелет,

«Вот он, мужчина», — говорим о нем.

Значение имени:
«мужественный» (греч.).

Дней поминовения множество, в том числе 28.04, 17.08, 19.09, 04.10, 09.11.

Личность. Настоящий мужчина.

Характеристика имени Андрей по буквам

А — трудолюбие;

Н — избирательность симпатий;

Д — чувство долга, ответственности;

Р- профессионализм;

Е — покровительство Зевса;

И — темперамент, неуправляемость.

Что означает имя Андрей по нумерологии

АНДРЕЙ = 165962 = 11, число Прозерпины, особо одаренных неординарных людей нового уровня сознания, «детей индиго».

Что означает имя Андрей по астрологии

6-5 (Венера — Юпитер) — отличительные качества, гармония и властность;

6-5 (Венера — Юпитер) — эстетство, интеллигентность, щедрость, приветливость, отзывчивость;

5-9 (Юпитер — Нептун) — благородство, любовь к ближнему;

9-6 (Нептун — Венера) — сочувствие, религиозность, доброта;

6-2 (Венера — Луна) — оккультные способности, но и излишняя доверчивость;

2 (Луна) — точка углублена: прекрасный тонкий вкус; люди с таким типом личности — столпы общества, они великие дипломаты и пользуются доверием у масс.

Кармические уроки имени

3 (Марс) — самокритичность ярко выражена: управлять настроением — кредо имени;

4 (Меркурий) — недостаток методичности, дисциплины;

7 (Сатурн) — много талантов, нужно стремиться их реализовать;

8 (Уран) — легкомыслие в финансовых вопросах.

Характеристика имени Андрей с учетом анализа

Андрей — аскет, эстет, необычайно умен, проницателен, обаятелен, остроумен, сострадателен, имеет ярко выраженные оккультные способности, ясновидящ, ясносышащ.

Недостатки
: Андрей быстро очаровывается и так же быстро охладевает, нередко бывает безжалостен, нетерпелив, надменен, эгоцентричен. Но он умеет вдохновлять людей на творчество, поэзию. Стремится к высокому карьерному росту, и это ему удается. В целом он весьма привлекателен, неординарен.

В сексе изобретателен. Он — страстный муж и любовник. Имена женщин значения не имеют.

Сексуальность имени Андрей

Он очень чувствителен, любит лесть, комплименты. С женщинами внимателен и заботлив, это нежный возлюбленный. Перед партнершами не изливается цветистыми комплиментами, но никогда не упустит случая показать им, как он ценит их прелести. Дайте ему возможность вволю поговорить об этом. Его любовным приключениям нет числа. Для Андрея любовь чаще всего является формой самоутверждения в эротической сфере, признанием его сексуальных способностей, которые он может считать развитыми недостаточно.

Бывает, что сексуальная жизнь Андрея начинается довольно поздно, что его первой женщиной становится его жена, и он до свадьбы не осознает полностью своих сексуальных возможностей.

Он быстро привыкает к изменениям обстановки, любит доставлять женщине радость даже в ущерб себе, просит ее рассказать о своих желаниях. Во время первой встречи он может быть сексуально активным, но иногда ему хочется просто обнять свою женщину и заснуть рядом с ней.

Для того, чтобы проявить высокие сексуальные качества, Андрей должен любить. В любви ему необходима терпеливая женщина, способная понять его сложности и разделить с ним радость, он ненавидит любое проявление грубости со стороны партнерши. Будучи по натуре страстным, он не слишком переживает любовные неудачи (в основном это относится к «зимним» мужчинам).

«Зимний» Андрей не изменяет жене и сам никогда не потерпит не только ее измены, но даже и легкого флирта с другим мужчиной. Он превосходный любовник, полон энергии и бодрости, своим элегантным видом может привлекать красивых женщин.

Здоровье и таланты имени Андрей

Ловкий, удачливый, временами жестковатый, не очень щепетильный в выборе методов для достижения цели. Высокая активность в сочетании с силой позволяет Андрею добиваться много. Хороший организатор, признанный лидер. Мгновенно реагирует на изменение ситуации и использует ее с выгодой для себя. Мечтательный в детстве, Андрей, повзрослев, становится реалистом и лучше сверстников устаивается в жизни, он импульсивен и непредсказуем. Рожденный зимой больше тяготеет к профессиям, связанным с искусством.

Рожденный осенью, более удачливый и расчетливый, преуспевает в области точных и естественных наук и в бизнесе. Андрей всегда стремится к идеальной любви, женится на красивой, эмоциональной, внешне эффектной женщине, не слишком интересуясь ее внутренним миром. Требует к себе повышенного внимания, ревнует жену даже к ребенку.

После женитьбы пытается сохранить независимость в сексе. Секс и любовь у него связаны неразрывно. Если он родился зимой — «зимний» Андрей никогда не изменяет жене и с ее стороны не потерпит не только измены, но даже легкого флирта. Отношения с тещей складываются очень непросто.

Отчества Андреев

Независимо от расположения звезд во время рождения Андреи с отчествами Александрович, Абрамович, Игоревич и Олегович тяжелы в общении, обладают сложным характером.

Характеристика Андрея по мнению Б.Хигира

С детского возраста Андрей обладает богатой фантазией. Излюбленные игрушки у него — это всевозможные конструкторы. Он может изображать автомобиль и гонщика одновременно, носиться при этом по квартире и издавать всю гамму звуков — от урчания мотора до скрипа тормозов. Поглощенный своей игрой Андрей мало обращает внимания на просьбы вести себя потише и чуть ли не единственное, что его может остановить — это сладкое. Если есть брат, то Андрей искренне привязан к нему. К сестре относится ревниво и не хочет уступать ей ни в чем. Андрей-подросток среди своих сверстников ничем особенно не выделяется, однако со временем оказывается, что в жизни он преуспел больше других. На службе Андрея всегда ценит начальник. Андреи, рожденные зимой, больше тяготеют к области искусств. Среди Андреев часто встречаются режиссеры, актеры, певцы, художники. В сфере естественных наук больших успехов добиваются «осенние» Андреи. Они же удачливы и в бизнесе. В отношениях с девушками Андрей непостоянен. Он может признаться в любви своей знакомой, а на другой день, не обращая на нее внимания, пройти мимо с другой. Женится Андрей на красивой, чувственной женщине, при этом ее внутренний мир и характер его мало интересуют. Советы знакомых и родственников о серьезном отношении к выбору спутницы жизни Андрей игнорирует. Андрей высокого о себе мнения, эгоистичен и требует к себе повышенного внимания. Он может ревновать жену к ребенку, если ома уделяет много внимания малышу, а ему — мало. Андрей непредсказуем в своих поступках. Он может сделать дорогой подарок жене, а по поводу пустяковой вещи устроить скандал. Отношения с тещей складываются сложно. Андреи с отчествами Александрович, Игоревич и Олегович трудны в общении и имеют непростой характер.

Гороскоп имени «Андрей»

Знаки Зодиака, покровительствующие Андрею – и , а планеты – Уран и Солнце. Его растения-тотемы – пихта и анемон, а животное – камышовый кот. Счастливыми для Андрея являются густо-красный и темно-коричневый цвета, а янтарь принесет ему удачу, если он будет носить камень с собой. Хорошим талисманом послужит также аметист.

Дополнительная характеристика имени Андрей:

Вибрация
: 85 000 к/с

Самореализация
(характер
): 88 %

Психика
: проявляет творческий подход ко всему, но в серьезных вопросах относится по-философски к проблемам жизни.

Андрей и домашние животные

Зимний Андрей отличается критическим складом ума и остроумием. Осенний – спокойный, расчетливый; в его доме себя будут хорошо чувствовать афганская борзая, английский сеттер. Весенний Андрей легкомысленен, великодушен, беспечен. Летний – весельчак, любитель развлечений и красивой жизни, ему трудно заботиться еще и о животном в доме, если он заводит собаку, то все заботы ложатся на плечи жены или детей.

Андрею следует давать собакам клички
: Клод, Конрад, Адель, Эмма, Айна, Зита, Лайма, Тэффи, Аргон, Бекки.

Популярность и статистика имени

Имя Андрей, которое родители давали сыну при рождении, довольно популярно. На 1000 новорожденных мальчиков это имя получали (в среднем по периодам, Москва):
1900-1909 годы: (не в десятке)
1924-1932 годы: (не в десятке)
1950-1959 годы: 66 (4 место)
1978-1981 годы: 84 (5 место)
2008 год: (10 место)

Известные люди с именем Андрей

Андрей Первозванный (один из наиболее почитаемых святых, первый из учеников Христа, брат апостола Петра)
Андрей Вознесенский (советский и российский поэт, один из известных поэтов-шестидесятников)
Андрей Боголюбский (великий князь Владимиро–Суздальский)
Андрей Миронов (актёр театра и кино, народный артист РСФСР)
Андреа Бочелли ((род. 1958) итальянский певец (тенор))
Андрей Рублев (мастер московской школы иконописи)
Андрей Сахаров (ученый-физик, академик и политический деятель, диссидент и правозащитник, лауреат Нобелевской премии мира)
Андрей Туполев ((1888 – 1972)авиаконструктор)
Андрей Воронихин (великий русский зодчий)
Андрей Тарковский (известный кинорежиссёр и сценарист)
Андрей Макаревич (певец, телеведущий, лидер рок-группы «Машина времени»)
Андре Шенье ((1762 — 1794) французский поэт, публицист и политический деятель)
Андре Моруа ((1885 — 1967) французский писатель)
Андре Ситроен ((1878 — 1935) создатель концерна «Citroën»)
Андрей Платонов (русский писатель)
Андрей Руденский (российский актер театра и кино)
Андрей Сова (советский киноактёр)
Андрей Белый (русский писатель, поэт, критик)
Андрей Громыко (советский государственный и политический деятель, дипломат, доктор экономических наук)
Андрей Мягков (российский актёр театра и кино)
Андрей Синявский (писатель, литературовед, критик, публицист, диссидент, политзаключенный)
Андрей Аршавин (российский футболист, заслуженный мастер спорта России)
Андрей Михалков-Кончаловский (советский и российский режиссёр, сценарист)
Анджей Вайда ((род. 1926) польский кинорежиссер)
Анджей Сапковский ((род.1948) польский писатель-фантаст)
Андреас Папандреу ((1919 — 1996) греческий экономист, государственный деятель, премьер-министр Греции)
Андре-Мари Ампер ((1775 — 1836) французский физик и математик)
Андре Франку Монтору ((1916 — 1999) бразильский политический деятель)
Андреа Мантенья ((ок.1431 — 1506) итальянский художник)
Андрес Сеговия ((1893 — 1987) испанский гитарист и композитор)
Андерс Бодельсен ((род.1937) датский писатель)
Андерс Цельсий (Андерс Цельсиус, шведский метеоролог, астроном и математик (1701-1744))
Андерс Якобсен (Андеш Якобсен, норвежский лыжник, прыгун с трамплина)
Онджей Секора (чешский писатель, публицист и художник)
Андра Николич ((1853 — 1918) сербский политический деятель)
Антеро Маттинен (финский виолончелист, бывший участник группы Apocalyptica)

Имя Андрей произошло от древнегреческого слова «Андрос», что в переводе означает «мужчина», «мужественный». После принятия христианства имя стало распространяться и на Руси, до этого оно было известно только в Византии. В те времена Именем Андрей называли только отпрысков благородных семей, затем имя распространилось и среди простого народа.

В советское время пик популярности пришелся на 70-е годы прошлого столетия, когда Андреями называли каждого четвертого новорожденного мальчика. На сегодняшний день имя так же популярно, как и несколько столетий назад.

За долгие века энергетика имени Андрей стала только сильнее. Множество выдающихся личностей, с интересной судьбой и талантами, носящих это победоносное имя — прямое тому доказательство. Среди них великий физик и теоретик Андрей Сахаров, поэт и публицист Андрей Вознесенский, режиссеры Андрей Кончаловский и Андрей Тарковский, великий русский художник Андрей Васнецов, спортсмен Андрей Аршавин и многие другие.

Именины и святые покровители

Впервые имя Андрей появилось в церковном календаре благодаря Андрею Первозванному — ученику Иисуса Христа. Он был первым, кого Иисус призвал в апостолы (поэтому его и называют Первозванным).

Согласно преданию, Андрей первозванный обратил в христианскую веру множество народов, он благословил земли, на которых впоследствии были основаны такие города как Киев и Новгород. Апостол был схвачен язычниками и распят на кресте, который имел форму буквы Х. Так появился всем известный Андреевский крест, изображение которого имеется на государственных флагах некоторых стран, на орденах и медалях.

На Руси этот святой всегда пользовался особой любовью и почтением — он считается покровителем русской государственности и военно-морского флота. Император Петр Первый своим указом учредил Андреевский флаг и Андреевский орден.

Андрей может праздновать именины один раз в году, выбираю дату максимально приближенную ко дню своего рождения: 26 и 27 января; 17 и 21 февраля; 7 марта; 28 апреля; 31 мая; 3, 5, 11, 15, 23, 25 и 26 июня; 3, 13, 17, 19, 22 и 25 июля; 5 и 17 августа; 1, 6, 19, 20, 23 и 28 сентября; 3, 5, 6, 7, 15, 23, 30 и 31 октября; 9 и 11 ноября; 8, 10, 11, 13, 15, 16 и 23 декабря.

Характеристика имени

Андрей наделен импульсивным и непредсказуемым характером, он очень увлекающаяся личность и мечтатель. Невозможно угадать, что ему придет в голову в следующее мгновение. Его внутренний мир очень сложен, хотя по его поведению это совсем незаметно. Он шутник и балагур, оптимист и весельчак, способен заразить своей энергией всех окружающих. Но не стоит обманываться, Андрей достаточно злопамятен, он все замечает и все запоминает.

Андрей всегда стремится к спокойствию и стабильности, старается не лезть на рожон и не вступать в сомнительные авантюры. За добросовестность и ответственность его ценят коллеги по работе, а за хорошее чувство юмора и отзывчивость — женщины и друзья. Своим обаянием он может покорить кого угодно.

Несмотря на то, что Андрей достаточно самокритичный человек, у него часто бывает завышена самооценка. Он падок на лесть, любит, когда на него обращают внимание и выделяют и совершенно не выносит конкуренции. Окрыленный успехом мужчина может внезапно стать заносчивым, тщеславным и самоуверенным, что может оттолкнуть от него людей.

Андрей любит «пустить пыль в глаза», представляя себя в лучшем свете, чем есть на самом деле. Он не желает прислушиваться к советам, всегда отстаивает свое мнение. Девушкам придется столкнуться с непостоянством Андрея, обещания любви и верности он может раздавать направо и налево. Очередной подруге мужчина может рассказать о себе все, как на исповеди, но ей не стоит обольщаться — всего о нем ей не узнать никогда. Все его стремления и желания сосредоточены на собственной личности.

Характер Андрея во многом зависит от того, в какое время года он родился. Рожденный в зимние месяцы, мужчина будет обладать принципиальным характером, не потерпит лжи и несправедливости, но с девушками будет обходителен и романтичен.

Осенний Андрей выстроит свою жизнь по четко намеченному плану, в котором не будет места случайностям и неожиданностям. В этом ему поможет самодисциплина, пунктуальность и аналитический склад ума.

Летнего Андрея природа наделит великолепным чувством юмора, легким характером и жизнелюбием. Этому парню будут рады в любой компании.

Весенний Андрей будет отличаться несерьезным отношением к жизни, легкомыслием и непостоянством. Он будет жаждать приключений и новых ощущений, а вот семья его будет интересовать мало.

Детство

Маленький Андрюша — тихий и спокойный ребенок, очень ласковый с мамой, к которой он нежно привязан. Он достаточно энергичен, но прекрасно умеет играть в спокойные игры в одиночку. С удовольствием соберет конструктор или починит поломанную игрушку.

Андрюшу трудно заставить слушаться и подчиняться, так как он достаточно строптив и непослушен. Он может долго спорить с родителями, настаивая на своем.

В школе Андрей учится неплохо, но и не отлично, среди своих сверстников выделяется разве что аналитическим складом ума и склонностью к конструированию и программированию. С девочками Андрюша не дружит, предпочитает общество мальчиков. Подросток часто увлекается спортом, любит играть в шахматы и шашки.

У мальчика обостренное чувство справедливости, из-за которого он может иногда конфликтовать с учителями. В жизни класса участия не принимает, старается избегать любой ответственности.

Учителя и родители должны помнить, что силовое воздействие на Андрея совершенно бесполезно, необходимо пользоваться аргументированным убеждением, принимая во внимание его врожденное чувство справедливости.

Здоровье

У Андрея с детства может быть слабое зрение и предрасположенность к простудным заболеваниям. В зрелом возрасте возможны проблемы с желудком и кишечником.

Особое внимание нужно обратить на душевное состояние, поскольку стрессы и депрессии могут стать причиной развития многих заболеваний. Немаловажную роль в поддержке душевного комфорта могут сыграть близкие люди Андрея, которые могут вселить в него оптимизм и веру в собственные силы.

Сексуальность

Сексуальная жизнь Андрея начинается не слишком рано, но потом юноша наверстывает упущенное. Он нежный и чувственный любовник, старается доставить удовольствие женщине даже в ущерб себе.

Андрею нравятся высокие и красивые девушки, а вот ее характер и внутренний мир его почти не интересует. Главное для него — эффектная оболочка. К своей избраннице он нежен и внимателен, однако чаще всего им руководит не любовь, а желание произвести впечатление.

В сексе Андрей не терпит грубости и насилия, а также отсутствия у своей партнерши женственности. Мужчина очень падок на лесть и комплименты, поэтому если женщина хочет обратить на себя внимание, ей не стоит скупиться на красивые слова.

Брак и семья, совместимость

Свою вторую половинку Андрей выбирает долго, обращая внимание, прежде всего, на эффектную внешность. Он хочет гордиться красотой своей супруги. Такое легкомысленное отношение к браку зачастую приводит к тому, что первый брак Андрея оказывается неудачным.

От своей спутницы требует повышенного внимания к себе, может ревновать даже к собственным детям. Измену не потерпит, но сам может с легкостью завести интрижку на стороне (исключение составляет Андрей, рожденный в зимнее время).

Все проблемы по хозяйству лягут на плечи супруги, но Андрей возьмет на себя полное материальное обеспечение семьи. Его избранница должна забыть о карьере и стать заботливой и сексуальной домохозяйкой. Также ей придется смириться с упрямством супруга и некоторой прижимистостью.

Удачный брак возможен с женщинами по имени Алевтина, Алиса, Алина, Диана, Елена, Елизавета, Ирина, Клавдия, Лариса, Людмила и Наталья. Лучше избегать отношений с Оксаной, Ольгой, Софией, Юлией, Верой, Анной и Яной.

Бизнес и карьера

Андрей подходит добросовестно к любому делу, кем бы ни трудился. Он обдуманно подходит к делам, не любит рисковать. Андрей уникальный человек, которому одинаково подходят как творческие профессии, так и инженерно-технические работы.

Он может стать актером, режиссером, литератором, художником и писателем, а может стать программистом, инженером, ученым, конструктором или менеджером. Он прекрасный исполнитель, умеет учиться на своих ошибках, поэтому начальство быстро оценит его по заслугам.

Самое главное для Андрея — достичь карьерных высот, которые будут повышать его авторитет в семье и среди друзей. При этом на первом месте будет стоять материальный достаток.

Андрей может быть вполне успешен в собственном бизнесе, который он будет вести честно и открыто. Партнеры могут быть уверены, что на слово Андрея всегда можно положиться.

Талисманы для Андрея

  • Планета-покровитель — Солнце.
  • Покровительствующий знак зодиака — Рак и Стрелец. Гороскоп рекомендует называть Андреями мальчиков, рожденных под этими знаками.
  • Удачное время года — лето. Удачный день недели — среда.
  • Счастливый цвет — желтый и коричневый.
  • Тотемное животное — камышовый кот. Это тотем сильных и богатых людей, так как позволить себе содержать этого хищника может далеко не каждый. Камышовый кот дарует власть, силу духа и мудрость.
  • Тотемное растение — анемона и пихта. Анемона — это декоративный цветок с небольшим красным пятнышком, символизирующий одиночество, печаль и сострадание. Пихта — это символ гордости, терпения и настойчивости. Это растение олицетворяет людей, сумевших отказаться от своих низменных желаний, и которым уготована дорога в рай.
  • Камень-талисман — янтарь и аметист. Янтарь это талисман для творческого человека, он дарует вдохновение и веру. Амулет, изготовленный и з янтаря, привлечет счастье и удачу для Андрея. Но янтарь нельзя оправлять в серебро, для него лучше всего подойдет медная оправа. Аметист — это камень мира, покоя и духовной благодати. Камень улучшает самочувствие и защищает от дурного глаза.

Гороскоп

Овен
— это неуравновешенный мужчина, ранимый и обидчивый. Он неугомонен и упрям, что делает его жизнь яркой и насыщенной разными событиями. Его настроение часто меняется, он может даже проявить агрессию, но все это лишь следствие огромной неуверенности в себе. Импульсивность и максимализм, свой свойственная Андрею-Овну, делает его неуживчивым человеком, с которым нелегко найти общий язык. Но принципиальность по отношению к себе и к окружающим, умение собраться и принять верное решение в нестандартной ситуации вызывают уважение коллектива. Для своей супруги Андрей-Овен будет надежным спутником жизни, но измена жены поставит окончательную точку в их отношениях. Он вспыльчив, но отходчив, умеет признавать свою вину, сострадать и прощать. Лучшей спутницей жизни для Андрея-Овна может стать женщина-Стрелец — им никогда не будет скучно вместе, их отношения со временем будут только крепнуть.

Телец
— чувственный и сентиментальный мужчина, для которого главной движущей силой является любовь и стремление к материальному благополучию. Он умеет ждать, анализировать и сопоставлять факты, никогда никуда не торопится. Со стороны он может казаться медлительным и даже глуповатым, но на самом деле Андрей-Телец мыслит очень глубоко и объемно. Он всегда объективен, к его мнению и советам стоит прислушаться. Он никогда не влезает в склоки и не слушает сплетен, не любит командовать и сам никому не подчиняется. Мужчина старается создать гармонию вокруг себя, не выносит шума и суеты. Его любовь рождается медленно, мексиканские страсти не для него. Но если мужчина полюбит, он способен разрушить любые стены и преграды. В любви Андрей-Телец большой собственник и ревнивец, но зато в его семье всегда будет материальный достаток, а своим детям он станет заботливым отцом. Лучшей парой для Андрея-Тельца станет женщина-Весы — они будут прекрасно дополнять друг друга.

Близнецы
— любознательный, общительный человек, ищущий беспроблемных путей в жизни. Он избегает любых трудностей и нудной работы, часто не может довести до конца начатое дело. Андрей-Близнец страдает болезненной чувствительностью, может даже заболеть от переживаний по поводу пустяковой ссоры. Ему очень важно, что о нем думают окружающие, критику переносит очень болезненно. Мужчина непоследователен в своих мыслях и поступках, не видит большого греха в обмане. От его излишней эмоциональности страдают как окружающие, так и он сам. Он может обижаться по любому поводу, а также шумно радоваться из-за пустяков. Его эгоцентризм заставляет мужчину «перетягивать одеяло на себя» везде, где только можно. Позерство — это его основной бич, мешающий развиваться и двигаться вперед. При этом Андрей-Близнец наделен недюжинным умом и интеллектом, это талантливая и разносторонне развитая личность. Хорошей парой для Андрея-Близнеца может стать женщина-Овен — это будет гармоничный союз, в котором роли будут распределены поровну.

Рак
— сентиментальный и чувствительный Андрей, но он не любит показывать этого внешне. Он теряется в незнакомой обстановке, старается ничем не выделяться из толпы. Мужчина очень нуждается в эмоциональной поддержке, в жизни всегда ищет заботу и тепло, без которых просто не может существовать. Он обладает феноменальной интуицией, но мало ей доверяет и часто совершает глупости. Андрей-Рак легко поддается панике и отчаянию, ему рудно вступать в новые отношения, еще труднее кардинально менять что-либо в жизни. Но, не смотря на это, он может принимать решения и целеустремленно двигаться к цели, особенно если чувствует за собой надежный тыл в виде любящих его людей. Обретя уверенность, Андрей-Рак способен многого добиться в жизни. Он очень ориентирован на семью, ради которой готов на все. Внешне Андрей-рак выглядит уверенным и сильным мужчиной, чем располагает к себе женщин. Он легко влюбляется, но также быстро остывает. Понять тонкую натуру своего избранника сможет женщина-Скорпион — она сумеет удержать отношения на чувственном и доверительном уровне.

Лев
— темпераментный, благородный и тщеславный мужчина, привыкший всегда и во всем быть лучшим. Он уверен, что весь мир должен вращаться вокруг него и не иначе. У него яркая харизма, делающая его заметной личностью в любом обществе. Андрей-Лев падок на лесть, но терпеть не может критики, поэтому старается окружить себя людьми, которые разделяют его мнение. Прямолинейность мужчины иногда граничит с грубостью, а неудачи и ошибки его никогда не смущают. Он прирожденный лидер, никогда не ограничивается сиюминутными целями, всегда стремится к глобальным перспективам. Честность и благородство заставляют Андрея-Льва бросаться в открытый поединок, а не строить козни за спиной. Он одинаково неистов в любви, дружбе и ненависти. В качестве спутницы жизни Андрей-Лев будет искать эффектную женщину, с которой не стыдно выйти в свет. Он будет настоящим главой семейства, нежным и заботливым, но вспыльчивым и ревнивым. Лучшей парой для него может стать женщина-телец — она будет будить его чувственность и усмирять непомерные амбиции.

Дева
— тонко чувствующая, интеллектуальная личность, обладающая высокой работоспособностью и глубоким интеллектом. В коллективе он может быть незаметен, и только близкие люди могут знать, насколько это яркая и самобытная личность. Андрей-Дева тонкий стратег, он всегда сумеет найти оптимальный выход из любой ситуации. Он очень аккуратен и чистоплотен, любую работу выполняет безупречно. Он не потерпит в своем окружении людей ленивых и неаккуратных, но излишняя подозрительность и придирчивость нередко становится причиной конфликтов. Андрей-дева очень независим, у него на все имеется собственное мнение, переубедить его почти невозможно. Он с трудом идет на компромиссы, а некоторая высокомерность и эмоциональная холодность может привести к тому, что Андрей-Дева коротает свою жизнь в одиночестве. Лишь настоящая любовь заставит его идти на компромиссы и прощать любимой ее недостатки. Привязанность, верность и чувственную любовь может подарить Андрею-Деве женщина, рожденная под одним с ним знаком зодиака — этот союз будет просто идеальным.

Весы
— это серьезная, прагматичная и обстоятельная натура, чьи слова никогда не расходятся с делом. Он темпераментен и горяч, но может быть нерешителен, если надо принять важное решение. В мужчине очень много противоречий, он постоянно находится в поиске гармонии, очень ценит свою свободу и стремится к независимости. Он везде и во всем ищет то, что придаст его жизни стабильности. Андрей-Весы может производить впечатление безвольного человека, так как часто не может отказать человеку в чем-либо, а потом из-за этого переживает. При появлении трудностей мужчина предпочитает тихо переждать в сторонке, а не рваться в открытый бой. Он очень ценит дружбу, всегда протянет руку помощи, причем совершенно бескорыстно. Но он не потерпит никакого унижения своего достоинства — в этом случае Андрей-Весы сумеет проявить несвойственную ему жесткость и напор. В любви мужчина обладает необузданным темпераментом, он наслаждается флиртом и обожанием женщин. Идеальным вариантом для длительных отношений может стать женщина-Водолей — эта пара сможет многого добиться в совместной жизни.

Скорпион
— сентиментальный мечтатель, последний романтик и дамский угодник. У него превосходно развита интуиция, его практически невозможно обмануть. Со стороны кажется, что он ходит по краю пропасти, бездумно идет на риск, но на самом деле Андрей-Скорпион никогда не перешагивает грани разумного, у него все рассчитано и находится под контролем. По натуре он не агрессивен, но для своих врагов смертельно опасен. Если Андрей-Скорпион поставил перед собой цель, он будет двигаться к ней на пролом. Он является отличным работником и руководителем, ответственным и справедливым. Мужчина обладает магическим влиянием на людей, ему верят и следуют за ним. Несмотря на сильный характер, Андрей-Скорпион очень нуждается в любви, но не каждая партнерша способна вынести капризность, упрямство, а иногда и агрессию этого мужчины. Для брака ему лучше всего подойдет женщина — Рыбы, так как она терпелива, умна и чувственна — то, что нужно этому неординарному мужчине.

Стрелец
— жизнерадостный, оптимистичный мужчина, обладающий неиссякаемым обаянием. Он смотрит на жизнь философски, никогда не впадает в крайности и держится всегда достойно и спокойно. Андрей-Стрелец любит учить и учится сам, раздавать советы направо и налево. У него открытая и широкая душа, много друзей и знакомых, которым он готов помогать орально и материально. Он никогда не лжет, не приспосабливается и не играет, от окружающих требует такого же отношения. Он известный борец за правду и справедливость, отменный дипломат, способный направить переговоры в нужное русло. Он прямолинеен и напорист во всем — в работе, дружбе и любви. Мужчина долго ищет идеальную спутницу жизни, поэтому в брак вступает довольно поздно. В душе он романтик-бродяга, который вовсе не стремится к оседлой семейной жизни. Можно сказать, что он не создан для семьи, и редко какой женщине удается задержать его возле себя надолго. Это может получиться у женщины-Рака, но только в ом случае, если мужчина, устав от одиночества, почувствует необходимость в тихой уютной гавани.

Козерог
— амбициозный, осторожный и практичный человек, двигающийся вперед медленно, но верно. Он никогда не рискует зря, а точно просчитывает ситуацию и собственные силы. Он очень не любит беспорядочной, импульсивной деятельности, всегда все тщательно планирует. Он прекрасный организатор и исполнитель, уверенно шагающий по карьерной лестнице. Как руководитель он внимателен к людям, но в то же время требователен и строг. На людей производит благоприятное впечатление, но под маской благолепия иногда может скрываться цинизм, высокомерие, недовольство всем и вся. По натуре Андрей — Козерог меланхолик, всегда готов впасть в истерику и депрессию, если что-то идет не так. Любви боится, так как боится страданий и душевных терзаний. Умеет четко разделять любовь и секс, предпочитая второе. Крепкая семья может получиться в паре с женщиной-Водолеем — их ожидает блестящее будущее.

Водолей
— непредсказуемая, свободолюбивая личность, с сильно развитой интуицией. Он постоянно меняется, примеряет на себя различные маски, экспериментирует как в работе, так и в общении. Он мыслит абстрактно — это настоящий изобретатель, умеющий видеть нестандартно и творчески. Некоторые считают его занудой и большим педантом, а некоторые гением. Очень часто мужчине кажется реальный мир серым и скучным, и тогда он погружается в свои мечты, в свой вымышленный мир. Тем не менее, Андрей-Водолей очень общителен, артистичен и всегда имеет вокруг себя множество друзей и товарищей. Он не страдает карьеризмом и первым готов откликнуться на помощь нуждающемуся, причем совершенно бескорыстно. Свою избранницу мужчина часто идеализирует, представляя ее в лучшем свете, чем есть на самом деле и закрывая глаза на ее недостатки. По этой причине он часто ошибается в выборе и бывает несчастлив в личной жизни. Андрей-Водолей может создать крепкую семью с женщиной-Львом — они будут уважать независимость друг друга, но им придется научиться идти на уступки.

Рыбы
— мягкий, мечтательный мужчина с хорошим воображением, которому никогда не скучно в одиночестве. Это интересная личность, но у него есть одна особенность — он всегда стремится приукрасить действительность, поэтому часто становится объектом насмешек. Хорошее чувство юмора помогает Андрею-Рыбы выжить в этом циничном мире. Он как никто умеет слушать и сопереживать, но старается не привлекать к себе внимания в обществе. Мужчина не расчетлив, не амбициозен и не высокомерен, поэтому ему трудно достигнуть карьерных высот. Но он совершенно не нуждается в помощи, так как часто упивается своей жертвенностью, и никакой другой жизни ему не нужно. Завоевать сердце Андрея-Рыбы очень сложно, еще сложнее удержать его, соответствовать тому образу, который он нарисовал в своих фантазиях. Он старается избегать прямого влияния на себя, хотя очень нуждается в поддержке и понимании, к тому же пользуется успехом у женщин. Стать идеальной спутницей жизни для этого неуверенного в себе мужчины сможет стать женщина-Козерог — она не будет метаться и нервничать по пустякам, являя собой образец спокойствия и уверенности.

Какое большое счастье — рождение ребенка! Сколько приятных забот для мамочек, папочек, дедушек, бабушек, одним словом — вся родня в заботах. Особо приятный момент — выбор имени для новорожденного.

Это очень ответственное решение, имя человека имеет огромное значение, подходить к этому вопросу нужно со всей серьезностью. Для мальчика отличное имя Андрей. Значение имени, его происхождение, совместимость с другими именами и знаками Зодиака — все нужно знать перед тем, как назвать своего малыша.

Происхождение имени и его значение

Значение имени Андрей для мальчика очень важно для его родителей, остановивших на этом имени свой выбор. Имя это очень гордое и мужественное, между славянских народов довольно распространенное. Красиво звучит — Андрей. Значение имени, его корни нужно искать в Древней Греции. Его основу составляет греческое слово «андрос», что в переводе означает «муж, мужчина, мужественный». Много веков это имя считается исконно русским. Во времена крещения Руси оно попало к нам из Византии.

Имя Андрей, происхождение и значение которого описывается в данной статье, заставляет людей, услышав его, сразу почему-то представлять мужчину с твердым характером, сильного, уверенного в себе, одним словом — мужественного! Такое представление довольно правдивое и соответствует характеру и внешности его обладателя.

Имя Андрей, происхождение и значение которого одинаково у разных народов, звучит в разных языках по-разному. Французы, например, произносят Анри, словаки — Ондрей, молдаване — Андрияш, но значение имени при таких вариациях ничуть не меняется.

Андреи — счастливчики! На протяжении года они несколько раз могут праздновать свои именины: 13 декабря, 13 и 17 июля, 23 сентября. Вот сколько праздников за один год!

Маленькие Андрюши

Значение имени Андрей для ребенка важно, так как маленькие детки уже отличаются своими характерами. Малыш, которого зовут Андрюша, любит иногда схитрить, любит помечтать в тишине. Его действия подвластны настроению. Сейчас он носится по комнате, как жужжащий самолетик, через пару минут его совершенно не слышно — маленький архитектор уже строит из конструктора дом.

Андрюши — большие сластены и очень любят сладости, по этой причине у многих из них проблемы с зубами. Родителям нужно обратить на это особое внимание.

Заставить слушаться и подчиняться мальчиков с таким именем очень проблематично, они, как правило, строптивы и непослушны. Если мама хоть как-то может найти подход к такому ребенку, то с отцом он начнет обязательно спорить, настаивая на своем решении. Упрямство, которое дети при этом проявляют, поражает. Если в семье есть младшая сестричка, то братик по имени Андрей не будет уступать ей ни в чем, из-за этого частые ссоры между детьми неизбежны. С братом Андрюшка найдет общий язык, будет его любить и поддерживать.

Андрюши — подростки, отношения с девушками

Каково значение имени Андрей для мальчика-подростка? В подростковом возрасте у детей формируется характер, это уже не малыши, это личности, хоть еще и не взрослые. Андреи-подростки могут среди своих сверстников совершенно ничем не выделяться. Но по прошествии некоторого времени люди, находящиеся рядом с ними, начинают замечать, что ничем не приметный Андрей школу с отличием окончил, разряд по плаванью или боксу получил, да и в остальном у него полный порядок, жизнь устроена намного лучше, чем у бывших одноклассников.

Что касается первой любви, первой понравившейся девушки, то Андрей довольно непостоянен и коварен. Сегодня он клянется в вечной любви одной красавице, а на следующий день пройдет мимо нее, даже не повернув голову, да еще и с другой избранницей. Самое интересное то, что изменчивого Андрея такое поведение ничуть не смущает. В общении с девушкой он может много чего рассказывать о себе, но это не значит, что она все о нем будет знать. Скрытный парень правду о себе всегда припрячет.

Имя Андрей и профессия

В выборе профессии значение имени Андрей тоже играет роль. Среди людей с таким именем, рожденных в зимние месяцы, преобладают певцы, художники, актеры, режиссеры… Андреи, рожденные осенью, искусство считают несерьезным, они организованны, расчетливы и полностью на стороне естественных, точных наук.

В бизнесе им сопутствует удача, карьерный рост, начальство относится к ним благосклонно. Женская половина коллектива обязательно обратит на сотрудника с именем Андрей пристальное внимание. Он для них загадочен и непредсказуем, чем и вызывает к своей особе интерес.

Андрей: значение имени, характер, отношения в браке

Как уже говорилось раньше, мужчины-Андреи непредсказуемы. Человек настроения — Андрей, значение имени сказывается на отношениях в браке. Так как в семье сходятся люди с разными характерами, и ужиться двум разным личностям бывает порой совершенно невозможно, лучше заранее знать, чего ждать от своей второй половинки.

Жена Андрея может быть удивлена и обрадована неожиданным и дорогостоящим подарком, но буквально через несколько дней, попросив у мужа денег на дешевую мелочь, нужную в хозяйстве, она услышит категорическое «Нет». Никакие доводы о необходимости данной вещицы не помогут, Андрей ужасный упрямец и своего решения не меняет даже тогда, когда понимает, что не совсем прав.

Жену себе выбирает, как говорится в народе, «по одежке», ему важна ее красота, чтобы она эффектно смотрелась, была эмоциональна, а то, какой у нее характер, ему не интересно. Опять же хочется еще раз напомнить о его упрямстве, если невеста не нравится родственникам и друзьям и они приводят убедительные аргументы о том, что она ему не пара, то Андрей сделает все по-своему. Самомнение у него на высоком уровне.

Довольно эгоистичный и ревнивый мужчина по имени Андрей. Его артистичная натура постоянно требует внимания. Свою вторую половинку может ревновать даже к детям, когда он занимается с ними, забывая порой о любимом муже. Что тогда говорить после такого заключения о ревности к другим мужчинам? Конкуренции Андрей никогда не потерпит, он должен быть на первом месте. Интересен еще тот факт, что с тещей найти общий язык практически во всех случаях не получается.

Но при всем выше перечисленном необходимо отметить, что при своем эгоизме Андрей может до умиления трогательно заботиться о своих близких, устраивать шикарные праздники, шиковать, но такие эпизоды быстро сменяются другими, которые покажут Андрея скуповатым самолюбивым мужчиной.

Андрей: имя, значение, совместимость с другими именами

Как бы ни были расположены звезды в момент появления на свет Андрея, он вырастет с очень тяжелым и сложным характером, с ним будет трудно общаться при условии, что его отчество будет одним из перечисленных: Александрович, Абрамович, Игоревич, Олегович.

Не советуется таким мужчинам создавать семью с женщинами по имени Варя, Зоя, Клара, Нелли, Оксана, Ольга, София, Юля.

Намного лучше будет, если судьба сведет Андрея с женщиной, которую зовут одним из перечисленных имен: Алевтина, Веста, Данута, Джульетта, Диана, Елена, Елизавета, Ирина, Клавдия, Лариса, Лия, Людмила, Мария, Наталья, Таисия.

Совместимость со знаками зодиака

Наилучшие знаки зодиака для Андрея — Рак и Овен. Если ребенок родился под одним из этих знаков, если вы назовете его Андрюшей, то знак поможет мальчику открыться в своих наилучших качествах.

Рак (22.06 — 22.07) — поможет Андрею раскрыть перед близкими людьми свое ласковое и доброе отношение к ним. Количество друзей и доброжелательных коллег увеличится, благодаря выпущенной на волю веселости.

Овен (21.03 — 20.04) — под защитой овна Андрей полностью сможет открыть свой потенциал и свои незаурядные способности. В результате такой человек вполне может стать первооткрывателем, путешественником, исследователем нового и неизученного.

Все «За» и «Против» имени Андрей

Мы все узнали об имени Андрей, значение имени этого выяснено, но прежде чем назвать им своего сына, необходимо взвесить все плюсы и минусы.

Это имя очень интересное и красивое, но именно поэтому оно слишком распространенное, и в одном классе с сынишкой могут быть еще 4-5 Андрюшек.

Мальчика по имени Андрей можно называть многими ласкательными именами: Андрейка, Андрюшенька, Андрюша, Андрюха. Это имя красиво звучит почти во всех случаях не только в сочетании с отчеством, но и с большинством фамилий. В итоге фамилия, имя, отчество человека звучат очень красиво. Плохо то, что у Андреев чрезмерно сложный характер, перевоспитать или переломить его невозможно.

Рассмотрев хорошие и плохие стороны этого имени, можно смело сделать заключение о том, что положительные стороны побеждают. Сильный, смелый, настойчивый, мужественный Андрей — разве не красиво звучит?

Имя Андрей
произошло от древнегреческого слова «андрос», что в переводе означает мужчина, также его можно перевести как «отважный, мужественный, смелый». На Руси имя приобрело популярность после принятия христианства, до этого оно было распространено в Византии. Считалось, что младенец с именем Андрей будет всегда под покровительством небесного ангела-хранителя.

Андрей – черты характера

В детстве мальчик отличается высокой энергичностью и изобретательностью. Маленький непоседа часами может носиться по квартире, а потом также долго сидеть и что-нибудь мастерить. Обладает живым, ярким воображением – любая безделушка в его руках становится значимой игрушкой. Старательность Андрюши выражается буквально во всем.

В школе учится средне, активно принимает участие в жизни школы, полученное задание выполняет добросовестно, подходя к нему со всей ответственностью. Не терпит несправедливости и всегда защищает слабых.

Андрей – душа компании, весельчак, «живой анекдот»; он общителен, остроумен, умеет наладить контакт даже с трудными людьми, а особенно с девушками. Такие качества как целеустремленность, коммуникабельность помогут ему добиться успеха во всех делах. Андрей – надежный и хороший товарищ, в случае необходимости примчится на помощь даже ночью, за это друзья его очень ценят. Но если вы обидели Андрея – берегитесь! Обид он не прощает, хоть и держит негатив в себе.

В отношениях с женщинами непостоянен. Легко расстается с одной, причем без угрызений совести, а на следующий день гуляет уже с другой. Андрей изобретательный и пламенный любовник, старается угодить партнерше и нередко имеет несколько женщин одновременно.

Однако если представитель этого имени влюбился по-настоящему, он с легкостью прощается с холостяцкой насыщенной жизнью и выходит на новый семейный уровень существования. Для брака Андрей ищет живую и общительную леди, с которой есть о чем поговорить, а не примитивную домохозяйку, вечно расхаживающую в халате и бигудях.

Андрей – совместимость имен

Для создания семьи обладателю данного имени нужно искать Анжелику, Алису, Валерию, Антонину, Веронику, Алину, Галину, Дину, Ларису, Марию, Людмилу и Наталью.

Непрочный брак может сложиться с Варварой, Ольгой, Оксаной, Ириной, Зоей, Викторией, Екатериной, Верой, Анной и Яной.

Известные люди с именем Андрей

Русский живописец А. Рублев, князь А. Трубецкой, поэт А. Белый, писатель А. Платонов, А. Гончаров – народный артист СССР, А. Миронов – талантливый актер, А. Макаревич – композитор, певец, телеведущий и другие.

Андрей – интересные факты об имени

— планета-покровитель – Солнце, Уран;
— зодиак имени – Стрелец, Рак;
— цвета, приносящие удачу, – стальной, темно-коричневый, густо-красный, сиреневый;
— камень-оберег – янтарь, аметист;
— растение – пихта;
— животное – камышовая рысь.

Комментарии

Вероника 14.04.2016

Мой идеал мужчины, сконцентрирован в одном имени — Андрей. Еще будучи подростком, у меня были отношения только с Андреями)) Ну, как-то судьба нас сводит)) И сейчас, я снова с Андреем, по-моему — это надолго! Классные они, эти Андреи!))

Анечка 14.04. 2016

У меня Андрей брат. Про женщин — сущая правда. Если ему что-то не нравится — он запросто прервет отношения, на какой бы стадии они не были. И с такой же легкостью — найдет другую девушку. Но это не значит, что он не может иметь сильные чувства, просто, нужно найти ту самую!

Андрей. Имя андрей знак зодиака телец

Имя Андрей произошло от древнегреческого слова «Андрос», что в переводе означает «мужчина», «человек». От него произошло имя Андреас, которое на Руси переименовалось в Андрея – «храбрый», «мужественный», «смелый». После принятия христианства имя стало распространяться и на Руси, до этого оно было известно только в Византии. В те времена Именем Андрей называли только отпрысков благородных семей, затем имя распространилось и среди простого народа. В советское время пик популярности пришелся на 70-е годы прошлого столетия, когда Андреями называли каждого четвертого новорожденного мальчика. На сегодняшний день имя так же популярно, как и несколько столетий назад.

За долгие века энергетика имени Андрей стала только сильнее. Множество выдающихся личностей, с интересной судьбой и талантами, носящих это победоносное имя — прямое тому доказательство. Андрей — очень непредсказуемый человек. Никто не может поручиться за то, какой он шаг сделает в следующую секунду. В Андрее сочетаются такие качества как трезвый расчет и расточительность, спокойствие и эмоциональность, серьезность и веселость, при этом важно, в какое время года был рожден носитель данного имени.

Характеристика имени Андрей

Соответствующий знак Зодиака
: Скорпион ♏.

Покровительствующая планета
: Венера ♀.

Доминирующая стихия Фен-шуй
: Дерево 木.

Талисман-камень, минерал, металл
: Аметист.

Талисман-цвет
: Сиреневый, Желтый, Коричневый.

Талисман-дерево
: Клен 🍁.

Талисман-растение
: Анемон.

Талисман-животное
: Камышовый кот.

Наиболее удачный день
: Суббота ♄.

Счастливое время года
: Осень 🍂.

Особенности характера
: Трудолюбие, Решительность, Терпеливость, Непостоянство, Тщеславие.

Весенний Андрей
отличается легкомыслием и беспечным отношением к жизни. Его великодушие никого не оставит равнодушным, поэтому у него много друзей. А вот второй половинке летнего Андрея придется несладко, ведь он жаждет приключений и развлечений, тогда как заботы о содержании семьи его мало интересуют.

Летний Андрей
– настоящий весельчак и балагур, которому рады в любой компании, ведь его смешные истории и прекрасное чувство юмора всем поднимают настроение. Благодаря своему легкому характеру и жизнелюбию он пользуется повышенным вниманием у женщин.

Осенний Андрей
обладает аналитическим складом ума, он пунктуален, дисциплинирован и привык выстраивать свою жизнь по четко составленному плану, в котором нет места случайностям. Неудивительно, что он тяготеет к точным, а также естественным наукам, что впоследствии помогает ему стать успешным предпринимателем.

Зимний Андрей
– творческая личность, которая найдет себя на поприще режиссера, актера, певца, поэта или художника. Он справедлив, но при этом мягок, не приемлет лжи и равнодушия. Из-за мягкого характера и принципиальности часто наживает врагов, поскольку яростно отстаивает свои убеждения. В отношениях с девушками зимний Андрей обаятелен, обходителен и романтичен.

Характер имени Андрей

Тайна имени раскрывается при знакомстве с Андреем. По своей природе это веселый и жизнерадостный человек. Одиночество не для него. Любит шумные компании, практически всегда находится в центре внимания. Отзывчив, всегда спешит прийти на помощь друзьям. Родные и близкие купаются в его ласке и внимании. Своим обаянием может покорить практически каждого.

Андрей — самокритичный, уравновешенный человек, который должен держать все под контролем. Знает себе цену, но часто имеет завышенную самооценку. Любит, чтобы ему уделяли много внимания. Не терпит конкуренции. Легко может выйти из себя, если кто-то другой вместо него вызовет больше заинтересованности в компании.

Положительные черты имени Андрей
: Легкость в общении, веселый нрав, душевность, трезвый расчет, упорство и настойчивость в достижении цели. Андрей умеет защитить свои интересы и интересы дорогих ему людей. Он честен, даже благороден, ищет справедливости. Андрей может покровительствовать, помогать, участвовать в решении проблем других людей, но не безоглядно, а до определенного предела.

Отрицательные черты имени Андрей
: Перепады в настроении, ранимость, чувствительность, нетерпимость к обидчикам, мстительность, язвительность. Ему внезапно может все надоесть и наскучить. Удачливый Андрей самоуверен, заносчив, забывает о тех, кто помог ему достигнуть успеха. Он высокого о себе мнения, горд, эгоистичен, требует к себе повышенного внимания, часто непредсказуем в своих действиях. Неудача в жизни может привести Андрея к депрессии, унынию, бездействию, моральному разложению.

Увлечения и хобби

Увлечения Андрея разносторонние и порой несовместимые. Это творческая личность. Он может заниматься боксом или единоборствами, а может увлекаться философией, музыкой, актерским мастерством, писать стихи и прозу, рисовать.

Профессия и бизнес

Андрей — очень трудолюбивый человек. Часто считает, что всего добился сам, и это отчасти является правдой. Высокая самооценка Андрея и его уверенность в себе, несомненно, способствуют карьерному росту. Если же добавить к этим качествам добросовестность и исполнительность, то становится понятно, почему он пользуется уважением у начальства. С подчиненными и коллегами Андрей тоже отлично ладит, а все благодаря обаянию, чувству юмора и умению подобрать к каждому человеку нужный ключик. Артистичность Андрея и его стремление быть всегда в центре внимания найдут выход в творческих профессиях (из Андрея получится хороший актер, композитор, художник, певец, писатель или режиссер). Отзывчивость и добродушие носителей этого имени как нельзя кстати придутся в профессии спасателя, пожарного или врача. Но Андрей – не альтруист, а потому профессию будет выбирать такую, которая сможет принести ему финансовую стабильность и независимость. Немаловажным фактором для него является и престижность выбранного поприща.

Практичность Андрея и его рациональность способствуют тому, что он добивается больших успехов в предпринимательской деятельности. Он не любит рисковать, а все свои действия продумывает на несколько ходов вперед, поэтому заранее знает исход того или иного предприятия, той или иной сделки. При этом свой бизнес он ведет честно, за что его уважают партнеры.

Психика и здоровье

Чаще всего носители имени Андрей обладают холерическим типом мышления. На первый взгляд Андрей производит впечатление оптимистичного, открытого, веселого, простого и жизнерадостного человека, но не стоит доверять первому впечатлению. На самом деле Андрей редко открывает свою душу людям, поскольку очень тяжело переживает обиды и предательства. Его нельзя открыто критиковать и сомневаться в его способностях. Стимулировать его лучше похвалой и поощрением. По отношению к своим врагам Андрей непримирим, поэтому лучше сто раз подумать перед тем, как вступать с ним в конфронтацию.

Здоровье Андрея достаточно крепкое, но охлаждения и сырого климата ему лучше избегать, так как он расположен к заболеваниям органов дыхания. А вот своему душевному состоянию Андрею следует уделить особое внимание, поскольку стрессы и депрессии могут стать причиной развития многих других заболеваний. Андрею нужно выработать в себое стойкий оптимизм, чтобы преодолевать депрессию, которая иногда будет охватывать его. Главной заботой в области здоровья должна быть психологическая релаксация, очень важно устранение нервного напряжения.

Любовь и секс

Непостоянство Андрея проявляется в личной жизни: несмотря на свою нравственность, до момента вступления в брак он не отличается постоянством, обосновывая это тем, что должен выбрать самую лучшую женщину, которой посвятит всю свою жизнь. Такое поведение приводит к тому, что представительницы прекрасной половины человечества обижаются на Андрея. Андрей крайне избирателен в выборе своей возлюбленной, которая просто обязана быть красивой, эффектной, умной, заботливой и эмоциональной. А вот внутренний мир любимой женщины интересует Андрея мало, поскольку основная ее задача – боготворить своего суженого, создавать уют и комфорт. Он всегда нежен и внимателен, однако чаще всего им руководит не чувство любви, а желание выглядеть в глазах женщины рыцарем и благодетелем.

В сексуальной жизни Андрей крайне восприимчив и чувствителен, он любит лесть, комплименты, а также повышенное внимание. Женщинам он готов дарить нежность и страсть, но лишь при условии, что они будут платить ему сторицей. Интересно то, что такие понятия как любовь и секс для Андрея неделимы, поэтому он не будет тратить ни своих душевных, ни физических сил на женщину, к которой не испытывает хотя бы чувства влюбленности. Дело в том, что для Андрея даже любовь является некой формой самоутверждения в сексуальной сфере и признанием его недюжинных способностей. Андрей может всецело отдаваться сексуальным утехам, а может захотеть отдохнуть от активной интимной жизни. Поэтому ему нужна терпеливая и понимающая женщина, которая сможет мириться с такими перепадами настроения Андрея. В своей партнерше он не потерпит грубости и отсутствия женственности.

Семья и брак

Андрей ценит семейные отношения. В жены он выбирает красивую и эффектную женщину (зачастую именно внешность становится решающим фактором при выборе супруги), которая обязательно должна нравиться его знакомым и друзьям (жена становится некой визитной карточкой Андрея). При этом нельзя не сказать о том, что Андрей все же женится по любви, но если его жена не будет соответствовать его высоким «стандартам», то он может увлечься другой женщиной. Интересно то, что измены свои он тщательно скрывает, продолжая играть роль примерного семьянина (развод для Андрея равносилен признанию его несостоятельности как настоящего мужчины).

Андрея тяжело назвать хозяйственным человеком (для этого у него есть жена, на плечи которой ложатся все бытовые проблемы), при этом он считает себя полноправным главой семейства, основная задача которого заключается в обеспечении семьи материальными благами. Поэтому рядом с Андреем уживется лишь заботливая и нежная женщина, готовая забыть о своей карьере и посвятить свою жизнь безраздельно своей семье. Эгоистичный и ревнивый Андрей требует к себе максимум внимания, поэтому вполне может ревновать жену к ребенку.

Гороскоп имени Андрей

Андрей-Овен ♈
– это достаточно неуравновешенная личность, подверженная частой и резкой смене настроения. Андрей-Овен может проявлять агрессию по отношению к окружающим, но такое поведение является лишь защитной реакцией, за которой скрываются ранимость и обидчивость. Андрею, рожденному под знаком Овна, нелегко найти общий язык с противоположным полом.

Андрей-Телец ♉
– неуверенность в себе и болезненное восприятие критики в свой адрес способствуют тому, что Андрей-Телец часто замыкается и отгораживается от социума. У него мало друзей, которые способны принять его таким, какой он есть. Для Андрея-Тельца самое важное – это семья, в которой он должен чувствовать заботу и поддержку.

Андрей-Близнецы ♊
– это человек с очень развитым воображением, поэтому ему легко найти себя в любой сфере и сойтись с любыми людьми. Недостаток его состоит в том, что он слишком зависит от мнения окружающих, что мешает ему проявить себя и свои возможности в полной мере. Андрей-Близнецы – свободолюбивая натура, но своей избраннице он свободу ограничивает.

Андрей-Рак ♋
– острый ум и прекрасная память помогают Андрею-Раку достичь невероятных успехов в работе. Он твердой поступью идет к намеченной цели, и никакие преграды не в силах его остановить. Его чувство собственничества распространяется не только на возлюбленную, но и на друзей.

Андрей-Лев ♌
– благородство, честолюбие и тщеславие – вот основные характеристики Андрея-Льва, привыкшего всегда и во всем быть лучшим. Эти качества помогают ему сделать прекрасную карьеру. Он нравится женщинам, но, выбрав ту единственную, не станет ей изменять, ведь семья у него стоит на первом месте.

Андрей-Дева ♍
– это неуверенный в себе человек, который ко всему относится недоверчиво и настороженно. Андрей-Дева испытывает внутренний страх перед принятием серьезных решений, поэтому ему нужна женщина, которая сможет подарить ему максимум тепла и любви, поддержит во всех его начинаниях.

Андрей-Весы ♎
– это серьезная, прагматичная и обстоятельная натура, для которой важны морально-этические аспекты жизни. Андрей-Весы – преданный муж, любящий отец, добросовестный работник. Его слова никогда не расходятся с делом.

Андрей-Скорпион ♏
– сентиментальный мечтатель, последний романтик – так можно охарактеризовать Андрея-Скорпиона, который все принимает слишком близко к сердцу. Ему свойственно проявлять и такие качества как капризность, упрямство и агрессию, поэтому его второй половинке надо набраться терпения и понимания.

Андрей-Стрелец ♐
– это покоритель женских сердец, в жизни которого одно любовное приключение сменяется другим, при этом всех своих женщин Андрей-Стрелец искренне любит, но и остывают его пылкие чувства очень быстро. Лишь оригинальная и необычная женщина может удержать возле себя такого казанову.

Андрей-Козерог ♑
– это трудолюбивый, упорный и крайне сознательный человек, который готов трудиться 24 часа в сутки ради достижения своей цели и благосостояния своей семьи. В жены Андрей-Козерог выбирает хозяйственную и домашнюю женщину, которая сможет стать для него настоящим тылом.

Андрей-Водолей ♒
– это мягкий, добродушный и чувственный человек с богатым воображением, который склонен идеализировать людей (поэтому часто Андрей-Водолей разочаровывается в людях, которые в итоге не отвечают его высоким идеалам). Крепкий союз возможен лишь с сильной и уверенной в себе женщиной, знающей себе цену.

Андрей-Рыбы ♓
– жизненные трудности могут привести робкого, уязвимого и впечатлительного Андрея-Рыбу к нервным срывам. Он с пониманием относится к окружающим людям, которым всегда готов помочь. Его любят дети и жена, которых он просто боготворит.

Совместимость имени Андрей с женскими именами

Андрей и Ольга
– это творческий союз, который строится на общих интересах, причем эти интересы могут быть как личными, так и деловыми. Но следует остерегаться определенной легкомысленности в отношениях, которая может поставить под сомнение доверие между партнерами Андреем и Ольгой.

Андрей и Анна
– очень интересная пара, которая может показаться странной, ведь Анна и Андрей далеки от реалий современного мира, в котором правят деньги и власть. Они сосредоточены друг на друге и на саморазвитии, но все же забывать о действительности не стоит, иначе отношения не сложатся.

Андрей и Елена
– и Андрей, и Елена не приемлют общепринятых норм, особенно если они не соответствуют их идеалам. Поэтому данный тандем в обществе часто не воспринимается всерьез, но пару это нисколько не смущает, ведь они живут своей обособленной жизнью, в которой им хорошо вместе.

Андрей и Юлия
– в этой паре не знают, что такое скука или тоска, ведь они оптимистично смотрят в будущее, строя общие планы. Страстную Юлию манят новые вершины и горизонты, которые они осваивают и покоряют вместе, тем самым наполняя свои отношения новой энергией.

Андрей и Анастасия
– этот крепкий союз основан на доверии, почитании традиций, трудолюбии и целеустремленности обоих партнеров. Любовь между Андреем и Анастасией – это симбиоз нежности, дружбы и доверия. А вот страсти в этих отношениях не хватает, что со временем может негативно сказаться на интимной стороне жизни.

Андрей и Татьяна
– дух приключений объединяет Андрея и Татьяну, их манят перемены и новые открытия. Несомненно, такой авантюризм не даст паре заскучать, но отсутствие стабильности может негативно отразиться на семейной жизни, особенно, когда у пары появятся дети.

Андрей и Екатерина
– принципиальность, стремление к лидерству и властность как объединяют партнеров (если Андрей и Екатерина будут вести совместный бизнес, то успех им гарантирован), так и разъединяют (часто партнеры начинают борьбу за власть в семье). Только терпение и понимание помогут сохранить этот союз.

Андрей и Наталья
– это далеко не гармоничный и не легкий брак, в котором женщина живет эмоциями, а мужчина – трезвым рассудком. Наталье хочется больше свободы, тогда как эгоистичный Андрей не готов идти на уступки своей возлюбленной.

Андрей и Ирина
– это прочный союз, в котором царят взаимопонимание, поддержка, любовь и абсолютное доверие. Ирина не стремится брать на себя роль главы семейства, напротив, она с удовольствием подчинит свою жизнь интересам семьи. Андрей любит и ценит свою супругу.

Андрей и Мария
– в этой паре оба партнера умеют радоваться жизни, при этом свои силы они предпочитают тратить на достижимые цели, а не на иллюзорные мечты. Андрей и Мария предпочитают не ссориться по мелочам, а решать все проблемы за столом переговоров, что помогает им сохранить нежные чувства.

Андрей и Светлана
– это очень благополучный союз, в котором удача сопутствует Андрею и Светлане во всем. Любовь, слава, богатство являются составляющими такого брака (главное – научиться не только получать от судьбы дары, а и отдавать их часть тем, кто в этом нуждается).

Андрей и Марина
– их отношения – пример для подражания. Андрей и Марина – инициативные и активные люди, которые постоянно пытаются привнести в совместную жизнь что-то новое и интересное, дабы быт не разрушил тех нежных и пылких чувств, на которых и основывается их брак.

Андрей и Кристина
– в этом тандеме Кристине отведена роль оратора, а Андрею – слушателя, при этом обоим такая позиция абсолютно подходит. Они не ссорятся и не конфликтуют, поскольку Андрей снисходительно относится к проявлению лидерства своей избранницы.

Андрей и Виктория
– несмотря на то, что союз между Андреем и Викторией может быть продолжительным, прочным его назвать нельзя. Когда страсть проходит, оба партнера живут по принципу «стерпится — слюбится», вместе их удерживают совместный быт и дети.

Андрей и Ксения
– такие отношения основываются на страсти и яркости, но независимость и свободолюбие обоих партнеров часто приводят к ссорам, в которых истина не рождается, а, напротив, теряется. Если Андрей и Ксения не научатся уступать друг другу, их брак обречен.

Андрей и Любовь
– схожесть характеров Андрея и Любы помогает им лучше понять друг друга. Они ценят свои отношения, к которым относятся очень трепетно. Их рациональность и практичность помогают сохранить отношения там, где более эмоциональная пара не смогла бы этого сделать.

Андрей и Яна
– и для Андрея, и для Яны брак – ответственный шаг, к которому они идут не один год, проверяя друг друга в различных ситуациях. Поэтому союз их зачастую очень прочен, поскольку партнеры прекрасно знают сильные и слабые стороны друг друга и умеют с ними мириться.

Андрей и Надежда
– в этой паре партнеры всецело концентрируются друг на друге и на своих отношениях, которые они выстраивают медленно, но уверенно. Надежде и Андрею не свойственны чрезмерная импульсивность и порывистость, что благоприятно отражается на их совместной жизни, в которой конфликты решаются на стадии возникновения.

Андрей и Алина
– внимательный Андрей любит Алину и боготворит ее за женственность и нежность. Алина ценит в своем партнере заботу и умение отстаивать свои интересы. Но карьерист Андрей может потерять семью, если не будет уделять ей должного внимания.

Андрей и Диана
– такие независимые индивидуальности как Андрей и Диана могут создать прекрасный партнерский тандем, тогда как в семейной жизни их амбиции и бескомпромиссность могут помешать построению крепких отношений.

Андрей и Евгения
– это очень прочный союз, в котором партнеры стараются удивлять друг друга, дарить новые эмоции, подпитывающие чувства. Андрей и Евгения любят путешествовать, причем рождение детей не мешает им странствовать. Это активная семья, в которой редко случаются конфликты и недопонимание.

Андрей и Дарья
– эту пару можно назвать идеальной, ведь цель обоих – создать крепкую семью, в которой царят гармония и понимание. Андрей и Дарья не борются за лидерство, предпочитая равноправие в отношениях.

Андрей и Олеся
– преданность, любовь, страсть – вот основа отношений Андрея и Олеси. Они умеют находить новые краски в обыденных вещах, что помогает им каждый день открывать новые грани друг друга.

Андрей и Алена
– это гармоничные отношения, в которых сексуальной жизни отводится одно из ведущих значений. При этом страсть между Андреем и Аленой не только не остывают, а, напротив, воспламеняются. Главное в этой паре – не допустить войны межличностных интересов.

Андрей и Маргарита
– чуткая Маргарита любит находиться в центре внимания, она эффектна и красива, что не только манит Андрея, но и постоянно поддерживает его интерес к своей партнерше. И здесь важно, чтобы Маргарита не заигралась с чувствами Андрея.

Андрей и Александра
– в паре Александры и Андрея нет места бурной страсти, поэтому и эмоциональных выяснений отношений между ними практически не бывает. В этом союзе царят разумный подход и практичность, но и нежности в них тоже есть место.

Андрей и Людмила
– это очень сложные отношения, в которых на первое место выходит не любовь, а упрямство партнеров, которое проявляется и в быту, и в семейной жизни, и в интимных отношениях. Если Андрей и Людмила смогут побороть это качество, то союз их будет ярким и длительным.

Андрей и Галина
– новизна и постоянное движение – вот основа союза между Андреем и Галиной, которые любят общение, приключения, перемены. Не достает этой паре лишь стабильности, а это немаловажно для настоящей сплоченной семьи.

Андрей и Полина
– в этой паре нет места эгоизму, ведь Андрей и Полина строят свой союз на любви, нежности и заботе, что помогает им преодолевать все трудности, встающие на их пути. Поставленных целей они добиваются вместе, поддерживая друг друга в любых начинаниях.

Андрей и Карина
– эти отношения больше напоминают взаимовыгодное партнерство, чем брак в традиционном понимании. Но от этого союз Андрея и Карины не становится менее прочным и продуктивным, но при условии, что обоим подходит подобный формат отношений, в которых нет пылкой страсти.

Андрей и Инна
– в этом союзе есть все: любовь, нежность, масса положительных эмоций. Нет лишь стабильности, которая просто необходима для создания крепкой семьи. Поэтому брак Андрея и Инны редко длится долго.

Андрей и Валерия
– авантюризм и желание перемен руководят этой парой, для развития отношений в которой жизненно необходимы эмоциональные всплески. Новые знакомства, новые места, новые впечатления способны вновь и вновь воспламенять чувства Андрея и Валерии.

Андрей и Алла
– это союз, в котором нет места обыденности, причем часто это отрицательно сказывается на взаимоотношениях Андрея и Аллы. Они умеют страстно любить и пылко ненавидеть, быть нежными и агрессивными. Чрезмерная эмоциональность партнеров приводит к тому, что в конечном итоге пара распадается.

Андрей и Елизавета
– эти непохожие люди прекрасно чувствуют себя в обществе друг друга, но разные жизненные ориентиры могут стать для Андрея и Елизаветы непреодолимым препятствием на пути к счастливой семейной жизни.

Андрей и Вероника
– это очень перспективный союз, объединяющий двух жизнелюбивых и энергичных людей, которые могут превратить свою жизнь в настоящий праздник. К тому же Андрей и Вероника – прекрасные любовники, что немаловажно в семейной жизни.

Андрей и Валентина
– если в паре Андрея и Валентины присутствует любовь, то союз их будет крепким и долгим, в противном случае отношения может разрушить измена партнера, для которого такие понятия как секс и любовь неразрывно связаны.

Андрей и Лилия
– эти двое обладают схожими характерами, что может как сближать их, так и отдалять. Все зависит от способности понимать друг друга, идти на уступки и смотреть в одну сторону. В целом Андрею и Лилии есть чему поучиться друг у друга.

Андрей и Лариса
– это страстный союз, в котором Андрею и Ларисе комфортно не только в интимной жизни, а и в быту. Эмоциональная Лариса умеет поддержать и приободрить рассудительного Андрея, к тому же оба они готовы идти на компромиссы.

Андрей и Тамара
– серьезной и требовательной Тамаре комфортно с весельчаком Андреем, который способен превратить жизнь своей избранницы в настоящее приключение. И здесь важно, чтобы Тамара научилась более легко относиться к жизни, иначе Андрею наскучит монотонная семейная жизнь.

Андрей и Антонина
– независимые Андрей и Тоня не спешат вступать в брак, и чем больше они оттягивают этот момент, тем меньше у них шансов на создание семьи. В целом свободолюбие обоих партнеров не располагает к крепкому союзу.

Андрей и Ангелина
– это союз людей, которые хотят получать от жизни все и сразу, их жизнь должна напоминать бесконечный праздник, при этом возвращение к реалиям нагоняет на них тоску. Отсутствие романтики и новизны могут привести к разрыву отношений между Андреем и Ангелиной.

Значение имени Андрей, которое несколько десятилетий находится на пике популярности, сочетает в себе множество положительных черт. Оно наделяет своего обладателя мужеством, храбростью и решительностью.

Андрей – русское имя, имеющее несколько версий происхождения (греческое, католическое и православное). Среди христиан самым почитаемым обладателем имени был Андрей Первозванный, являвшийся братом апостола Петра и первым учеником Христа. Жизнь свою святой закончил в городе Парты, где он был распят на кресте в виде буквы «Х» (позже данный символ стали называть «андреевским крестом»). Апостол Андрей в православии считается покровителем множества стран (Румыния, Греция, Украина, Россия) и военно-морских сил РФ. У католиков он почитаем в Сицилии, Бургундии и Шотландии.

Что означает имя для мальчика

Значение имени для мальчика важно учитывать еще во время его выбора. Андрей – непоседливый и активный ребенок, любящий играть и учиться чему-то интересному. В школе мальчик может даже стать отличником, если родители приложат к данному процессу некоторые усилия.

У маленького Андрея много разных интересов, среди которых особое место занимают животные. Если в доме будет питомец, он с удовольствием возьмет всю заботу о нем на себя. Если такого друга нет, то он непременно его заведет самостоятельно.

Серьезные изменения характера ожидают Андрея в подростковом возрасте. Он становится более самостоятельным, не нуждается в опеке родителей. Но обладатель имени занимает в коллективе позицию лидера, ему доверяют, прислушиваются к его мнению. Андрей, в свою очередь, поощряет окружающих своими знаками внимания, любит делать подарки и не скупится в финансовом и эмоциональном планах.

Что касается здоровья, то Андрея можно назвать одним из самых крепких. Опасность представляют только простудные заболевания, которые в детском возрасте раз за разом постигают ребенка, и возможное чувство хандры.

Характер и судьба, связанная с именем

Имя Андрей, значение и судьба которого неразрывно связанны, наделено различными чертами характера.

Андрей – непредсказуемый и импульсивный, мечтательный и быстро увлекающийся человек. Несмотря на то, что он на людях является шутником и балагуром, весельчаком и оптимистом, внутренний мир обладателя имени достаточно сложен. Парень может быть весьма злопамятным, он не прощает обмана и насквозь видит льстецов.

У Андрея не возникает желания встревать в различные авантюры, поскольку он любит стабильность и спокойствие. Парень считается ответственным и добросовестным, что ценят на рабочем месте. Для женщин его главными чертами характера являются отзывчивость, чувство юмора и обаяние.

Отличительной чертой имени является то, что его обладатель, хоть и наделен способностью к самокритике, он часто завышает собственную самооценку. Он любит потоки внимания к своей персоне и не переносит конкуренции. Если его затмит успех, то Андрей может превратиться в тщеславного и заносчивого человека, от которого отворачиваются окружающие. Но он быстро осознает, что был неправ, если на это укажут ему самые дорогие люди.

К одной из отрицательных черт характера относится желание казаться людям лучше, чем есть на самом деле. И даже если Андрею укажут на это, он будет отстаивать свои мнение и позицию.

С девушками у парня могут складываться различные отношения. Все зависит от его намерений, зачастую Андрей обещает «золотые горы» и любовь до гроба, причем сразу нескольким пассиям. С некоторыми женщинами он откровенен, может излить душу, рассказать обо всех своих проблемах. По крайней мере, так кажется спутнице, хотя узнать обо всех его тайнах не дано никому.

Характер обладателя имени зависит во многом от того, когда родился мальчик.

Сезонность является одним из наиболее влияющих факторов:
  1. Зима. Зимний Андрей не терпит несправедливости и лжи. Он обладает принципиальным характером, любит отстаивать свою точку зрения в любой ситуации. Отношения с девушками носят романтический характер, парень обаятельный и обходительный.
  2. Весна. Непостоянство и легкомыслие – главные особенности весеннего Андрея. Семейные дела и любовь для него всегда на втором плане. Главное – получить от жизни новые ощущения.
  3. Лето. Любитель жизни, обладатель прекрасного чувства юмора и легкого характера – все это относится к летнему Андрею.
  4. Осень. Наметить четкий план и неуклонно следовать ему по жизни – вот главное кредо осеннего Андрея. Неожиданности и случайности не для него, все просчитано до мелочей. Построить жизнь таким образом помогают пунктуальность, самодисциплина и умение аналитически размышлять.

В целом судьба обладателя имени выстраивается в зависимости от его характера и складывается положительно.

Когда Андрей празднует именины

Именины имени можно отмечать трижды за год:
  • 13 декабря;
  • 13 июля;
  • 1 сентября.

Совместимость с отчествами

Андрей – имя, которое сочетается со многими отчествами.

К нему подойдут следующие варианты:
  • Борисович;
  • Олегович;
  • Сергеевич;
  • Петрович;
  • Владимирович;
  • Андреевич;
  • Семенович;
  • Максимович;
  • Николаевич;
  • Богданович;
  • Матвеевич;
  • Степанович.

Бизнес и карьера

Андрей имеет творческие задатки, поэтому он может стать актером, режиссером, оратором, литературным деятелем или художником. При достаточном стремлении ему под силу овладеть и точными науками, добившись невероятных карьерных высот.

В коллективе к Андрею все относятся с теплом. Он является душой любой компании, имея при этом такие качества, как ответственность и высокая работоспособность. Если ему будет интересна та сфера, в которой он вращается, то Андрей будет еще и постоянно повышать свою квалификацию. Это ценится начальством, поэтому карьерный рост на любом поприще обеспечен.

Единственное, что может затруднить работу, это боязнь идти на рискованные поступки. Поэтому в бизнесе владелец имени продвигается медленно, просчитывая каждый свой шаг. Иногда это мешает развитию дела, но в конечном итоге дает свои положительные плоды.

Важно. Поскольку характер у обладателя имени весьма настойчивый, ему не сложно выбиться в лидеры и стать главой крупной корпорации.

Брак и семья, совместимость с женскими именами

Андрей всегда считает себя немного лучше других, поэтому его любовные отношения могут складываться проблематично: он ищет себе спутницу, которая должна добиться его. Обладатель имени долго выбирает вторую половинку, сочетающую в себе интеллектуальность, элегантность, красоту, мягкость характера и эмоциональную сдержанность.

Андрей требует от супруги повышенного внимания и отдает его взамен.
Он ревнив и требователен, поэтому при появлении в семье детей, не простит охлаждения чувств со стороны жены и переключения ее внимания на малышей.

Стоит отметить, что Андрей не склонен к изменам и сам не прощает их. Чтобы не ошибиться с выбором спутницы жизни, стоит знать о том, с какими женскими именами имеется повышенная совместимость, а с какими не удастся построить прочный союз.

Хорошая совместимость с женщинами по имени:
  • Мария;
  • Наталья;
  • Людмила;
  • Елизавета;
  • Елена;
  • Лариса.
Менее удачная совместимость с носительницами следующих именоформ:
  • Оксаной;
  • Софией;
  • Юлией;
  • Зоей;
  • Татьяной;
  • Галиной;
  • Валерией;
  • Лидией.

Из обладателя имени выходит прекрасный отец,
который может дать своим детям многое. Он с удовольствием учит уроки с ребенком, ходит гулять и принимает полноценное участие в его воспитании. Андрей никогда не забудет о подарке на день рождения своего чада и постарается исполнить все его мечты. Особую любовь он проявляет к дочерям, всячески балуя их и оберегая ото всех невзгод.

По дому мужчина вряд ли будет помогать, выполняя «женские» дела. Максимум, на что может рассчитывать супруга, – это приготовленный простой ужин без изысков. А вот все, что касается ремонта и прочей работы сильного пола, будет выполнено без лишних напоминаний.

Сложно складываются у Андрея и отношения с тещей. Он не любит, когда в семью лезут с советами и нравоучениями. Поэтому мама должна знать границы дозволенного, чтобы избежать серьезных конфликтов с мужем своей дочери.

Талисманы и обереги для мужчин с именем Андрей

У каждого имени имеются свои обереги и талисманы:
  1. Талисман-камень – аметист и янтарь. Аметист позволит защититься от сглазов и порчи, улучшит физическое и эмоциональное состояние. Янтарь способен привлечь удачу и счастье, наделить верой и вдохновением для начинания творческих процессов. Главное, не обрамлять этот камень в серебро, лучше всего выбрать медную оправу, которая не будет блокировать мощь талисмана.
  2. Талисман-животное – тотемным животным имени является камышовый кот, символизирующий богатство и силу, мудрость и власть.
  3. Талисман-растение – наличие в жилище или возле него пихты или анемоны обеспечит обладателя имени спокойной жизнью. Считается, что пихта помогает отказаться от пагубных привычек и низменных желаний, что в последующем станет хорошим задатком для пропуска в рай.
  4. Оберег – Андрею лучше всего носить с собой фигурки перечисленных талисманов, выполненных из соответствующих материалов. Что касается цвета, то оберег должен быть коричневым или желтым, поскольку именно эта цветовая палитра является счастливой для обладателя данного имени.

Андрей – имя для мужественных и настойчивых людей, поэтому среди них сложно встретить неудачников и подкаблучников. Обычно, это опора для родителей, жены и детей, надежный товарищ и отличный друг.

Выбирая имя ребёнку, родители часто не задумываются о его значении. А ведь оно должно не только красиво звучать. Имя – это судьбоносная линия, фактор планиды. Конечно, в значимость можно и не верить. Но как бы там ни было, факт остаётся фактом. Выбранное имя для мальчика играет важную роль в жизни.

По мнению астрологов, именем Андрей, которое имеет такие значения, как «мужественный» и «храбрый», начали называть мужчин в Древней Греции. После введения в 988 году в Древней Руси христианства это имя распространилось и в русском государстве. Оно пришло из Византийской империи. Интересно то, что сначала именем Андрей нарекали только мальчиков, рождённых в благородных семьях, лишь намного позже так стали называть детей, не принадлежащих к привилегированным сословиям.

Назвав сына Андреем, родители сознательно влияют на его дальнейшую судьбу. Ведь это имя пророчит мужчине такие качества, как реалистичный взгляд, мужественность, позитивный настрой, добросовестность, обаятельность, терпение, аккуратность, ответственность, трудолюбие, исполнительность. Наречённый именем Андрей мужчина всегда является душой компании, так как он способен быстро находить контакт с другими людьми. Такие социально обусловленные компоненты личности помогают Андрею неплохо устроиться в жизни. Многим кажется, что ему даётся всё очень легко. Но это не так. В действительности, чтобы добиться результатов, мужчине приходится прикладывать довольно много усилий, хотя его порой самого берут сомнения, что именно упорство и труд дают плоды. Андрей занижает свою самооценку, его внутренний мир очень сложен. Иногда он становится душой компании, может шутить, острить, играть на гитаре, рассказывать анекдоты или устраивать розыгрыши. В другой же раз он чувствует себя уверенней, когда остаётся в одиночестве.

Работа для Андрея является смыслом жизни. В основном он выбирает профессии, связанные с творчеством. Например, он может быть режиссёром, актёром, композитором, художником, певцом. Андрей хорошо разбирается в технике, но это ему неинтересно, ведь он гуманитарий. Помимо творческой деятельности, мужчина часто занимается точными и естественными науками, из него получается неплохой бизнесмен. Хорошо себя Андрей показывает в таких профессиях, как продавец бытовой и оргтехники, инструктор по вождению автомобилей, преподаватель труда, программист, инженер, учёный, конструктор или менеджер. За профессиональные качества, честное исполнение своих обязанностей и ответственность Андрея ценят коллеги и начальство. Главная задача заключается в достижении карьерных высот, ведь рост в профессии поднимет его авторитет в семье и среди друзей. Но на первом месте стоит материальный достаток.

Довольно часто Андрею хочется всё бросить, будь то служба или семья, и бежать, не оглядываясь назад. Это происходит из-за переутомления, так как мужчина обременяет себя обязанностями, которые не может выполнить. От необдуманных действий его сдерживает чувство долга и ответственность, хотя он тратит на преодоление душевных порывов огромное количество жизненных сил. Чтобы избежать неприятных последствий, нужно просто отдохнуть, отключиться от семейных забот и разного рода дел. Можно съездить на охоту, рыбалку или просто на природу, где и восстановить утраченные силы.

Характер имени Андрей

Мужчина, носящий имя Андрей, всегда такой, каким его хотят видеть окружающие люди. Для матери он ласковый и нежный сын, для товарища – настоящий друг, для жены – огненный любовник, для преподавателя – отличный курсант. Мужчина с удовольствием доставляет людям радость. Если же человек его не интересует, он становится противником. Причём к нему он проявляет неприязнь. Если недруг рассердит Андрея, последствия будут непредсказуемыми. Энергия не позволяет мужчине проявлять терпимость к врагам. Он, быть может, и не покажет вида, но едва ли забудет обиду.

У Андрея довольно противоречивый характер. Он может быть и мягким, и хитрым. Мужчина с таким именем импульсивен, он никогда не будет ничего делать, если ему самому невыгодно, пусть даже этими отказами он причинит боль ближним. Андрей добивается в своей жизни всего, чего хочет, так как способен «пустить пыль в глаза», представить всё в выгодном для него свете. Он расчётлив, эгоистичен, не имеет привычки советоваться, не прислушивается к мнению старших.

Андрей достаточно злопамятен.
Нельзя
его недооценивать
.
Хоть он балагурит и веселится, но в это время всё замечает и запоминает. Мужчина высокомерен, чтобы доказать своё превосходство, он может использовать шантаж либо скандалы. У Андрея есть и такая черта характера, как самокритичность. Это стабильное качество способствует саморазвитию. Он признаёт свои ошибки, но не терпит, когда на них указывают посторонние. Если же ему сопутствует успех, он может быть самоуверенным, заносчивым, тщеславным. Это отталкивает от него людей.

Мужчина с именем Андрей – несомненный лидер, вожак, организатор. Он ведёт за собой людей, преодолевает препятствия, находит выход там, где никто этого сделать бы не смог. Высокая активность в совокупности с силой позволяет добиваться того, что для других недостижимо. Ловкость, удачливость и мгновенная реакция влияют на ситуации, которые Андрей использует с выгодой для себя.

Случается так, что неудача вышибает Андрея из седла. Его охватывает депрессия, опускаются руки. Люди сторонятся мужчину, ведь от жизнерадостного человека мало что остаётся. Но Андрей и в этом случае справляется с неприятностями. Собрав в кулак силу характера, он обращает её против хандры. К нему в качестве подарка возвращается улыбка судьбы и удача.

Имя Андрей для мальчика

Выбирая имя для мальчика, родители предрекают его судьбу. Ведь в переводе с греческого языка это слово обозначает «храбрый». В детстве Андрюша, Андрейка, Андрейчик, Анди, Энди, Дюша (так его называют, пока он маленький) – это спокойный и тихий ребёнок, но в то же время энергичный. Он может бегать по дому, играя в подвижные игры, или в одиночку собирать, например, конструктор, составляя воображаемые предметы. В это время его практически не слыхать, так как он не требует к себе внимания. Маленький Андрей особенно близок к матери, он с ней нежен и ласков. Но вот подчиняться и слушаться не желает, так как очень строптив, капризен и упрям. Мальчик часто спорит с отцом, доказывая свою правоту. Но не стоит заострять на этом внимание. Ведь по натуре Андрей бесконфликтный, усидчивый, терпеливый, целеустремлённый, мечтательный, уверенный в себе. Если у ребёнка есть брат, то он с ним дружит, а вот с сестрой отношения развиваются не лучшим образом. Андрей постоянно с ней конфликтует, ни в чём не уступает.

У мальчика в детстве не очень хорошее здоровье. Он предрасположен к простудным высоко заразным инфекциям. Также у Андрея могут быть проблемы со зрением. Родителям следует обращать внимание на душевное состояние ребёнка, так как частые депрессии и стрессы могут стать причинами серьёзных заболеваний.

Повзрослевший подросток становится положительным по всем направлениям. У него меняется характер. Ему свойственны такие черты, как общительность, трудолюбие, обязательность, доброжелательность, постоянство, добропорядочность, позитивность, внимательность, красноречивость. Но сверстники считают его слишком скучным и нудным, поэтому как таковой дружбы у Андрея с ними не получается. Правда, на него никто не жалуется, да и конфликты между юношами не возникают. Зато позже выясняется, что подросток намного опережает ровесников по развитию, он всего в жизни добивается, дела у него идут успешно. Этого он достигает благодаря аналитическому складу ума, склонности к конструированию и программированию. Гарантами его успеха является целеустремлённость и сосредоточенность.

Но мальчик в подростковом возрасте старается избегать любой ответственности. Из-за обострённого чувства справедливости он часто конфликтует с учителями, которые не понимают, что на него нельзя «давить», нужно просто аргументировать убеждения. Андрей активно участвует в жизни коллектива, поручения выполняет добросовестно.

Андрей в молодости пользуется успехом у представительниц прекрасной половины. Он обладает множеством уникальных качеств, таких как загадочность и обольстительность. Он умеет угадывать желания девушек, поэтому легко завоёвывает женское внимание.

Брак и совместимость имени Андрей

Андрей легкомысленно относится к браку. При выборе спутницы жизни он в первую очередь обращает внимание на внешний вид – женщина должна быть красивой, высокой, элегантной, умной, выдержанной, а её внутренний мир и характер Андрея мало интересует. Главное желание мужчины не любовь, а произведённое впечатление. Правда, с представительницей противоположного пола он внимателен и нежен.

В молодости Андрей довольно непостоянен. Девушек он меняет часто, бывает, что каждый день. Им кажется, что мужчина с ними откровенен, ничего не скрывает, рассказывает о себе всё. Но это не так – Андрей никогда не будет изливать душу, не откроет сокровенные мысли.

Мужчина очень любит комплименты и лесть. Если женщина хочет обратить на себя внимание, она не должна скупиться на красивые слова. Кроме того, Андрей никогда не простит спутнице измены, хотя сам часто ходит «на сторону». Иногда он ревнует жену даже к своим детям, а отношения с матерью супруги довольно напряжённые.

Мужчина с именем Андрей полностью обеспечивает семью, но вот все домашние дела ложатся на плечи жены. Он запрещает ей даже думать о карьере, так как женщина обязана заботиться о нём и детях, быть сексуальной домохозяйкой. Жене надлежит быть более сильной по характеру, она должна ставить перед ним новые цели и задачи. Кроме того, она вынуждена терпеть упрямство супруга и его прижимистость. Импульсивный и непредсказуемый Андрей может преподнести жене очень дорогой подарок, а в следующий раз пожалеть деньги на копеечную вещь для использования в хозяйстве. Для Андрея общественные ценности на ступеньку выше милосердия и доброты, хотя он очень любит свою семью.

Но бывает так, что мужчина не может создать ячейку общества, так как слишком тщательно выбирает женщину по известным только ему характеристикам. Не найдя эмоциональную, внешне эффектную красавицу, в итоге он может всю жизнь провести в одиночестве. Но женившись, Андрей из-за чувства долга никогда не разрушает семью, пусть брак и будет неудачным.

Известные личности

Самым известным человеком, наречённым именем Андрей, является первый ученик центральной личности в христианстве (имеется в виду Иисус Христос) – апостол Андрей Первозванный. После его распятия на кресте в греческом городе Патры появился «Андреевский крест». Его используют в качестве символа на флагах некоторых стран и территорий.

Имя Андрей носят многие выдающиеся личности, оставившие свой след в истории:

  • академик АН СССР, занимающийся теоретической физикой, Сахаров;
  • публицист, художник, архитектор, поэт Вознесенский;
  • живописец, монументалист, педагог Васнецов;
  • кинорежиссёры и авторы многих сценариев: Михалков-Кончаловский и Тарковский;
  • известный и почитаемый русский иконописец московской школы Рублёв;
  • советские актёры: Миронов и Мягков;
  • русский авиаконструктор Туполев;
  • государственный деятель Андрей Громыко;
  • основатель ансамбля «Машина времени», который был создан в 1969 году, Макаревич;
  • футболист Аршавин, являющийся заслуженным мастером спорта России, и другие известные люди.

Это обычный ребенок, который может часами бегать по детской площадке, а, придя домой, собирать конструктор. Найти общий язык с ребенком-Андреем довольно сложно, так как он очень упрям и своенравен. Может капризничать, не слушаться, вести себя невоспитанно. Часто не признает авторитета родителей. И если мать он хоть иногда слушается, с отцом может откровенно конфликтовать. Иногда эта вражда проходит с возрастом, а иногда перерастает в настоящее противостояние. Чтобы этого не произошло, родителям необходимо быть терпеливыми, с пониманием относиться к поведению Андрея и ждать, когда он перерастет свои капризы. В данном случае поведение Андрея может существенно измениться в лучшую сторону.

Андрей не отличается усидчивостью, поэтому, учиться ему довольно сложно. В школе у него часто возникают проблемы с математикой и другими точными науками. Остальные предметы он учит по настроению. Иногда ему бывает просто скучно на уроках, тогда он начинает шалить и проказничать. Из-за этого некоторые учителя могут его недолюбливать. Андрей обладает ярко выраженной склонностью к спорту.
Любит участвовать в командных соревнованиях, дух соперничества пробуждает в нем волю к победе. Но Андрей ненавидит проигрывать. Поражение может настолько разочаровать его, что он потеряет интерес к спорту вообще.

Доверять людям Андрею непросто. Он не любит, когда кто-то знает его слишком хорошо, для него важно сохранять загадочность. Именно эта черта и привлекает к нему девушек. Однако на долгие отношения с Андреем рассчитывать не приходится. Он очень непостоянен и переменчив.
Поддавшись силе чувств, Андрей может сказать своей возлюбленной, что он будет с ней всегда. Но пройдет совсем немного времени, и он клянется в вечной любви и верности другой. Женщина для Андрея – это, прежде всего, красивая игрушка, пусть любимая, но игрушка. Он может баловать ее, заботиться о ней, но, при этом, совершенно не понимать ее и не интересоваться ее внутренним миром. По этой причине брак с Андреем очень часто распадается.

В профессиональном плане Андрей может добиться многого, если захочет. Но ему не хватает самоконтроля, дисциплинированности, ответственности. На работе его часто за это критикуют, однако избежать неприятностей Андрею помогает его обаяние, которым он умело пользуется.

Уменьшительно-ласкательные формы имени Андрей

Андрюша, Андрюшка, Андрюшенька, Андрюня, Андрейка, Андреюшка.

Андрей-Овен

Эмоциональный, часто неспособен контролировать свои чувства. В общении с людьми может быть довольно резок, однако это – всего лишь маска. Такому человеку необходим настоящий друг, который бы принимал его таким, какой он есть.

Андрей-Телец

Человек, ценящий своих родных. Главным в жизни для него является семья, именно там он ищет любовь и поддержку. С другими людьми ему ладить гораздо труднее.

Андрей-Близнецы

Отличается свободолюбием, однако подобное качество в партнере не признает. Любит быть в центре внимания, старается всем понравится. Это иногда приводит к тому, что он становится слишком зависим от чужого мнения.

Андрей-Рак

Карьерист и собственник, стремящийся получить все и сразу. Считает, что знает и понимает все на свете, однако это далеко не так. В личных отношениях склонен к доминированию, из-за чего часто остается один.

Андрей-Лев

Любит нравиться женщинам, но хранит верность своей избраннице. Стремится к долгим, прочным отношениям, мечтает о дружной, счастливой семье. Готов прощать своей возлюбленной многое, ожидая того же от нее самой.

Андрей-Дева

Страдает от неуверенности в себе. Постоянно ждет, что его кто-то похвалит или одобрит. Проще всего ему общаться с детьми. Такие люди становятся прекрасными отцами, отлично понимающими своих детей.

Андрей-Весы

Спокойный и уравновешенный. Свою избранницу любит беззаветно, пытается во всем ей угодить. Может быть мягким, покладистым, пока к нему относятся хорошо и со вниманием.

Андрей-Скорпион

Мечтателен, сентиментален. Нуждается в том, кто бы мог ее поддержать и по-настоящему понять. Влюбчив, раним. Готов на все ради своей возлюбленной, склонен ее идеализировать.

Андрей-Стрелец

Практичный, но, в то же время, может быть романтиком. Ценит и дружбу и преданность, не выносит лжи и предательства. Привязан к родителям, хотя может ссориться с ними по пустякам.

Андрей-Козерог

Усердный, исполнительный. Постоянно недоволен собой, стремится сделать все как можно лучше. Люди часто пользуются его покладистостью, что очень его огорчает.

Андрей-Водолей

Наделен довольно противоречивым характером. Эмоционален, склонен мечтать о несбыточном, рассуждать о жизни. Нуждается в более сильном партнере, способном заставить его поверить в себя.

Андрей-Рыбы

Склонен к меланхолии и даже депрессии. Впечатлителен, раним, уязвим. Ему сложно доверять людям, из-за чего у него может вовсе не быть друзей.

20344

Имя Андрей происходит от древнегреческого слова. По первой версии – от слова «андрос», что означает «мужа», «мужчину». По второй версии – от слова «андрейос», что переводится как «мужественный».

Мужское имя Андрей является русским православным. Сочетает в себе характеристики, коими не обладает в комплексе ни одно русское наименование. Имеется у него и хорошая символика, и также, совместимость со знаками Зодиака. А ниже мы поговорим обо всех этих параметрах как можно детальнее…

Популярность
: Имя Андрей колеблется между 11-13 местами в рейтинге популярности. По статистике, им именуют 253 мальчика из 1000 новорожденных.

Разговорные варианты
: Андреа, Андрес, Анджей, Онджей, Андра, Андрюна, Андрось, Андрюн, Андреечка

Современные английские аналоги
: Андрюха, Андрюша, Андрюня

Значение и толкование имени

Подпишитесь на наш канал

Это древнегреческое по происхождению имя (перевод — «храбрый»). Взрослому мужчине, значение имени Андрей в паре сего происхождением сулит такие качества как мужественность, обаятельность, красноречивость, позитивный настрой и реалистичный взгляд, добросовестность, терпение, аккуратность, ответственность.

Мальчик с именем Андрей, это обычно человек, который умеет признавать ошибки и легко принимает чужое мнение, потому как не любит конфликтные ситуации и проявления агрессии. Умеет философски рассуждать, отличный слушатель и советчик, прекрасный помощник. Ценит спокойствие, а посему нередко избегает шумных компаний и погружается в одиночество.

Достоинства и положительные черты:
обожает детей, красноречив и коммуникабелен, не зависит от окружения и может долгое время спокойно находиться в гордом одиночестве, трудолюбивый, но нуждается в стимуле, обожает достигать поставленных целей, легко адаптируется к окружению.

Андреи плохо относятся к:
неаккуратным, необразованным и необязательным людям, ненавидит несправедливость и ложь, плохо относится к людям корыстным.

На Руси имя Андрей появилось в X веке нашей эры и сразу же вошло в обиход. На данный момент считается одним из популярнейших.

Характер имени Андрей

Характер имени Андрей таков, что оно в первую очередь оказывает воздействие лишь на черты, связанные с коммуникабельностью названного так мальчика. Да, Андрей, благодаря значимости сей именоформы может обзавестись целым списком дополнительных качеств, но они будут только второстепенными. Главными, что сулит характер сего имечка, всегда будут такие как любвеобильность, чувствительность, романтичность, восприимчивость, обходительность и т.п.…

А еще характер сего имечка гласит о бесконечных проблемах с расставлением приоритетов – Андрей редко может определиться с приоритетом в целях и задачах, постоянно скитается между целями и никак не может определиться с тем, что для него важнее.

Раннее детство

В детстве мальчишку с именем Андрей практически незаметно, несмотря на то, что он подвижен и постоянно пребывает в поиске новых дел. А причина в том, что он не требует внимания и может часами проводить время в одиночестве, занимаясь каким-нибудь делом. Конечно, Андрей может и капризничать, и упрямствовать, и спорить, и более тог, может проявлять непослушание, но обычно причины всего этого столь ничтожны, что было бы глупым обращать на них внимание. А вообще, значение именоформы этот мальчика сулит такие черты как бесконфликтность, усидчивость, терпеливость, целеустремленность, уверенность в себе, независимость и свободолюбие – этому пареньку не требуется чье-либо восхищение, он готов проводить часы на пролет в одиночестве, и при этом никогда не заскучает. Хотя, в зависимости от покровительствующего знака зодиака все может быть и иначе…

Подросток

Подростка, названного такой вариацией как Андрей, сие имечко награждает такими характеристиками как обязательность, постоянство, трудолюбие, общительность, добропорядочность, доброжелательность, внимательность, красноречивость и позитивность – фактически, благодаря воздействию, что оказывает значение наименования, этот мальчишка становится положительным по всем направлениям. Но несмотря на то, что на него никогда нет жалоб и никогда ни у кого не возникают конфликты с ним, ужиться с такой личностью сложно – сверстники могут считать его слишком нудным и скучным, из-за чего и начнут отворачиваться. В данном случае многое будет зависеть от воспитания, влияния родителей, и его собственно моральной силы – родителям стоит уделить внимание воспитанию в нем силы духа и общительности, ибо в дальнейшем, в противном случае, у мальчика с именем Андрей могут начать возникать проблемы, притом везде, и в работе, и в личной жизни…

Взрослый мужчина

Взрослый Андрей, это независимый, свободолюбивый, обязательный, трудолюбивый, исполнительный и полный загадочности мужчина. Значение на этом этапе может одарять сразу целым комплексом полезных качеств, но в каждом они проявляются по-разному, в зависимости от животного по восточному календарю и влияния планеты-покровителя. А еще, обычно Андрей, это любвеобильный обольститель, старающийся всем казаться серьезным и постоянным – он старается казаться постоянным и не особо влюбчивым, но на самом деле не таков…

Взаимодействие характера Андрей с временами года

Зима – три месяца этого периода своим значением порождают творческую натуру, справедливого, мягкого, доброго и ответственного мальчика. Такой не переносит лжи и предательства, лицемерия и лести, чрезмерно правилен. При этом принципиален – люди избегают его по этой причине. Свое мнение может отстаивать до последнего, даже путем ссоры и агрессии. С дамами он иной – обаятельный, уступчивый, обходительный.

Лето – этот квартал одаряет прекрасным чувством юмора и характером, активностью и действенностью. Он умеет веселиться, в компаниях становится главным заводилой, балагур, умеющий рассказывать и заинтересовывать. Люди к нему тянутся, но он не постоянен – его оценят представительницы слабого пола, но побегут от серьезных отношений с ним.

Весна – наделяет легкомыслием, беспечностью, великодушием, общительностью, красноречием и любовью ко всему новому. Будет обожателем приключений, непостоянным, нестабильным, безответственным и «балованным». Его супруге придется нелегко – на него нельзя рассчитывать и полагаться, он подведет и глазом не моргнув. Зато он отменный отец – заботливый и любящий.

Осень – родившийся в осенние месяцы Андрей имеет хороший характер, станет по происхождению натуры и нрава пунктуальным и дисциплинированным, рассудительным, умным, прирожденным аналитиком, полагающимся на разум и логику. Это человек плана – следует принципам, любит точность. Легко станет успешным бизнесменом или ученым. А дамочкам с таким скучно, но зато безопасно!

Судьба имени Андрей

Судьба имени Андрей в любви, отношениях и семье такова, что этому мужчине придется бесконечно скитаться между пассиями в поисках той единственной, что сможет соответствовать его требованиям. Хотя сам Андрей страдать от этого ни в коем случае не будет, ибо напротив, ему приятно осознавать, что он нравится женщинам.

Но есть и большущий минус всего вышесказанного – такой расклад его личной жизни может привести к тому, что он до позднего возраста так и не обзаведется единственной любимой женщиной, а в итоге может и вовсе привести к одиночеству. Впрочем, это только теория – у каждого своя судьба и свое будущее…

Зато судьба предполагает еще один интересный параметр, но касающийся подросткового возраста, молодости – Андрей, это в молодости очень популярный мужчина с множеством уникальных качеств, загадочный и обольстительный, умеющий угадывать, чего хочет девушка, и таким образом легко завоевывающий женское внимание. Такой имеет огромный шансы на становление бабником и самым настоящим охотником за сердцами. К чему все это приведет, сказать сложно, судьба слишком непредсказуема, но факт остается фактом – с таким девушкам стоит быть осторожными.

Любовь и брак

Женятся все Андреи исключительно по любви – такова их суть. Андрей никогда не позволит себе строить отношения с женщиной на основе лжи, корысти или каких-то бесчеловечных намерений. Именно поэтому-то отношения и браки названных этим именем мужчин зачастую и являются удачными. Редко этим мужчины женятся во второй раз, настолько же редко, насколько редко разводятся с первыми женами. Для них развод равносилен признанию их несостоятельности.

В браке он может показать себя, как мужчину с хорошими манерами, кавалера, каких приводят в пример жены своим мужьям, хозяина и просто заботливого мужа. Он будет заботиться о жене, покупать ей подарки, ухаживать за ней так, будто они не живут вместе, а всего лишь встречаются, и вообще всячески ее ублажать. Но не стоит думать, что жизнь с таким мужчиной не будет иметь изъянов.

Изъяны в браке с Андреем имеются, да еще и в большом количестве. Главный из них, это неспособность Андрея быть по-настоящему верным и преданным мужем. Рано или поздно ему надоесть подчиняться супруге, надоесть однообразие в постели и жизни в целом, и тогда он пойдет налево. При этом никогда «роман на стороне» не станет причиной развода – из семьи он не уйдет.

Андрей как Отец

Как отец, Андрей может быть ответственным, добрым, внимательным, но не слишком ответственным. Ответственности всем Андреям-папам к сожалению, катастрофически не хватает. По крайней мере, так показывает практика и статистика. Но зато папа по имени Андрей, это всегда преданный своему ребенку отец, готовый на все ради счастья своего чада. Он всегда поддержит, послушает и выслушает до конца, посочувствует и проявит сострадание, если будет нужно, посоветует. Хотя в серьезных вопросах на него лучше не полагаться…

Привязываются Андрей, что к дочерям, что к сыновьям, одинаково. Для этих мужчин не важно, к какому полу относится ребенок. Главное, чтоб это была родная кровинка. И к слову, дети являются еще одним фактором, из-за которого Андрей никогда не пойдет на развод. Он может уделять детям мало внимания, может находиться круглые сутки на работе и забывать играться с детьми, но никогда не бросит их и не уйдет из их жизни.

Воспитание же детей ему лучше не доверять. Он вряд ли сможет научить ребенка тому, что поможет ему во взрослой жизни. Лучше уж воспитанием заниматься матери. Но что-что, а общительности, коммуникабельности и доброте этот папаша точно сможет научиться свое чадо.

Совместимость c женскими именами

Наилучшая совместимость у паренька с именоформой Андрей в плане отношений, любви, чувств и искренности наблюдается с такими женскими вариациями как Алиса, Нора, Яна, Тамила, Ксения, Дина, Владислава…

С такими как Изабелла, Ника, Лада, Нонна и Татьяна, имеются огромные шансы на построение счастливого, по-настоящему крепкого и долговечного брака. Конечно, разногласий тут не избежать, но такой брак выдержит и их, и многое другое.

А вот с Флора, Роза, Агата и Анна, союза лучше не создавать, ведь ничего хорошего из него стопроцентно не получится.

А вообще, этому умному и терпеливому мужчине нужна покладистая и добрая супруга…

Значение имени Андрей (Андрюша) — характер и судьба, что означает имя, его происхождение

Что означает имя Андрей «мужество», «мужчина», «человек», «мужское начало», «храбрец».

Происхождение имени Андрей: древнегреческое.

Имя Андрей произошло от древнегреческого имени Андреас. Оно переводится как «храбрый». Еще одно значение имени Андрей — «мужественный». Андрюша – творческий и неординарный человек. Он может пробоваться в спорте, музыке, литературе. Активный и решительный, с легкостью бросается на любые препятствия. С ним легко найти общий язык.

Сокращенное имя: Андрейка, Андря, Андрюха, Андрюша, Андрюшка.

Какое отчество подходит к имени: Александрович, Абрамович, Игоревич, Олегович.

Имя «Андрей» на английском (перевод) Andrey, Andrew (Эндрю), Andy (Энди). На испанском языке: Andrеs (Андрис), на немецком языке: Andreas (Андреас), на польском языке: Andrzej (Анджей), на украинском языке: Андрiй.

Значение имени для мальчика

Раннее детство: С самого детства Андреи проявляют свой непоседливый характер, который со временем меняется, но не существенно. Мальчики, названные этим именем, обычно доставляют много хлопот родителям. Они шумно себя ведут, не слушают замечания старших, любят вмешиваться в разговоры взрослых, часто капризничают, когда не получают того, чего хотят. Не уступить им в чем-либо нельзя, потому что при этом они могут и обидеться, причем на долгое время. Поэтому родителям Андрея необходимо воспитывать малыша с самого рождения, приучая его к дисциплине. Маленький Андрей обожает игры разного рода, хорошо ладит с другими детьми.

Подросток: Подростком любит что-то изобретать, производить химические опыты, собирать конструктор, сам придумывать новые модели. В школе Андрей учится хорошо, независим и горд, поражает одноклассников своей честностью, борется за справедливость, опекает слабых. За пределами школы живет своей жизнью, общественной работой не увлекается; Хорошо играет в шахматы, разбирает шахматные задачи.

В подростковом возрасте Андреи — завсегдатаи веселых компаний и шумных вечеринок. Они ни за что не согласятся проводить вечера дома, перед телевизором или с книгой в руках. У них, как правило, много друзей, но Андреи редко бывают формальными лидерами в компаниях, хотя и умеют располагать к себе окружающих.

Взрослый: Андреи умны, способны, талантливы от природы. Они легко постигают неизвестное им ранее и способны прилично справиться с любой работой, которую им поручат. Поэтому они, как правило, обладают завидной репутацией в рабочем коллективе. Обладатели этого имени часто становятся любимчиками начальства. Несмотря на это, они редко имеют завистников и недоброжелателей, потому что умеют очаровать любого.

Характер имени Андрей

Положительная характеристика имени: Андрюша идет по жизни, играя и улыбаясь. Дело в том, что он всегда такой, какого ждут увидеть окружающие: ласковый сын, верный друг, пламенный возлюбленный, отличный студент или работник, ответственнейший глава семьи… Причем Андрей всем кажется проще, чем есть на самом деле: например, жена может кокетничать при нем с другими довольно изощренно, а он охотно делает вид, будто его это тревожит. На самом же деле Андрюша очень великодушен и любит доставлять людям радость каким угодно образом. Мужчина Андрей — философ, умеет поддержать разговор с умным человеком, обменяться идеями. У мужчины есть потребность к самовыражению, проницательность, критический ум.

Отрицательная характеристика имени: Впрочем, когда человек не представляет для него интереса или превращается в противника, Андрей поворачивается к нему настолько противоположной стороной, что можно диву даваться! Сердить мужчину с этим именем не следует – плохо кончится.

Судьба имени Андрей в любви и браке

Обещает ли счастье в любви значение имени Андрей? Для Андрея очень важно женское внимание, при этом он стремится к тому, чтобы его было как можно больше. Для этого он заводит знакомства везде, где только можно. Любит флиртовать и обожает женщин, которые понимают его игру и охотно соглашаются на нее. На серьезные чувства обладатели этого имени часто оказываются не способны, а впрочем, они к нему и не стремятся, предпочитая легкие, ни к чему не обязывающие отношения. Поэтому, как только женщина начинает претендовать на долгосрочные связи, открыто проявлять ревность к другим представительницам прекрасного пола, Андрей незамедлительно спешит порвать отношения, которые могут его тяготить.

При выборе спутницы жизни Андрей, как правило, обращает особое внимание на внешность женщины, останавливая в итоге свой выбор на самой красивой и эффектной женщине из своею окружения, Если оказывается, что ум супруги во многом уступает ее красоте, Андрея это обстоятельство вряд ли расстроит, поскольку он искренне убежден в том, что умная и образованная женщина — это нонсенс. К тому же в браке Андрей редко бывает верен своей супруге, а потому отсутствие какого-либо качества в одной своей женщине он с легкостью компенсирует общением с другой.

После женитьбы Андрейка пытается сохранить независимость в сексе. Для него имеют особое значение секс и любовь, что связаны для него неразрывно. При всем при этом Андрей очень требователен к поведению супруги, не терпит измен и самостоятельно принятых решений. Требует к себе повышенного внимания, ревнует жену даже к ребенку. Он претендует на роль беспрекословного лидера и почти всегда играет ее в семейном союзе.

Отношения Андрея с собственными детьми нельзя назвать слишком теплыми, хотя дети ему дороги и при необходимости всегда получают значимую поддержку отца.

Если парень Андрей родился зимой — «зимний» — никогда не изменяет жене и с ее стороны не потерпит не только измены, но даже легкого флирта. Отношения с тещей складываются очень непросто.

Совместимость с женскими именами

Женские имена, подходящие Андрею:

  • Андрей и Елена
  • Андрей и Елизавета
  • Андрей и Марина
  • Андрей и Клавдия
  • Андрей и Лариса
  • Андрей и Людмила
  • Андрей и Мария
  • Андрей и Наталья

Неудачная совместимость имен:

  • Андрей и Варвара
  • Андрей и Зоя
  • Андрей и Оксана
  • Андрей и Ольга
  • Андрей и Софья

Таланты, профессия, карьера

Выбор профессии: Парень, названный Андреем, обладает литературным даром, владеет ораторским искусством. Он может иметь творческую профессию — режиссер, актер, художник; может заниматься точными науками.

Мечтательный в детстве, он, повзрослев, становится реалистом и лучше сверстников устраивается в жизни, он импульсивен и непредсказуем. Рожденный зимой больше тяготеет к профессиям, связанным с искусством. Рожденный осенью мужчина Андрей более удачливый и расчетливый, преуспевает в области точных и естественных наук и в бизнесе.

Благосостояние: Это мужественный и обаятельный человек, всем нравится, легко становится членом любого коллектива. Может Андрей перед начальством отстаивать интересы коллеги, поддержит веселую компанию, сыграет на гитаре, знает массу анекдотов. К работе относится очень добросовестно, никогда не жалуется. Придает огромное значение стремлениям к новому действию, но на риск он не пойдет.

Гороскоп имени Андрей

Андрей-Овен: человек неуравновешенный и переменчивый. Часто ведет себя агрессивно, но такое поведение — лишь маска. В душе Андрей-Овен очень ранимый, остро реагирует на любую критику в свой адрес. Особенно нелегко ему в общении с женщинами.

Андрей-Телец: подвержен частой смене настроений. Не уверен в себе, ему требуется поддержка близких людей, их совет и помощь. Главное место в жизни Андрея-Тельца занимает семья.

Андрей-Близнецы: человек с развитым воображением. Ему легко даются различные науки. Порой Андрей-Близнецы чересчур зависит от мнения общества, в котором находится. Он свободолюбив, однако любимому человеку свободу старается ограничить.

Андрей-Рак: обладает высоким интеллектом и великолепной памятью. Он способен любыми средствами добиваться намеченных целей, не останавливаясь ни перед чем- Это собственник, стремящийся подчинить себе друзей, семью, возлюбленную.

Андрей-Лев: натура благородная и честолюбивая. Умеет нравиться женщинам. Самое главное для Андрея-Льва — семья. Жене он будет предан беззаветно и #се свои силы отдаст на укрепление семейного очага.

Андрей-Дева: отличается крайней неуверенностью. Ко всему относится настороженно, испытывает внутренний страх. Андрей-Дева нуждается в любви и теплоте. Он будет замечательным отцом.

Андрей-Весы: очень серьезный и обстоятельный человек. Слишком привязывается к возлюбленной и попадает в зависимость от нее. Любовь его, как правило, верная и непоколебимая. Андрей-Весы будет преданным мужем и отцом.

Андрей-Скорпион: натура мечтательная и сентиментальная. Принимает все близко к сердцу- Он капризен, мучается загадками для самого себя, чрезмерно привязывается к людям. Ради своей семьи Андрей-Скорпион готов на любые жертва.

Андрей-Стрелец: мужчина-донжуан. Очертя голову, он бросается из одного любовного приключения в другое. Мгновенно влюбляется и также быстро остывает. Часто он разочарован в жизни. Андрею-Стрельцу нужна женщина оригинальная, только в этом случае его можно удержать.

Андрей-Козерог: упорный и сознательный человек. К сожалению, нередко позволяет недооценивать и эксплуатировать себя. Андрея-Козерога нужно воспринимать таким, какой он есть, в этом случае он станет заботливым и искренним партнером.

Андрей-Водолей: наделен мягкими чертами характера и богатым воображением. Ему свойственно вдохновение и честолюбие, он чувствителен и идеалистичен. Для натуры Андрея-Водолея характерна некая двойственность, понять которую трудно окружающим. Ему необходима сильная, уверенная в себе партнерша

Андрей-Рыбы: человек робкий, уязвимый, впечатлительный. Жизненные неудачи могут довести его до глубокой депрессии. Андрей-Рыбы очень чувственен, способен понять другого человека, становится нежным любовником.

День ангела Андрея: Андрей трижды в году отмечает именины:

  • 13 июля (30 июня) – Св. благоверный князь А.Боголюбскнй угодил Богу благочестием, заботами о бедных и больных, основал Боголюбский монастырь близ Владимира; убит своими приближенными в 1174 г.
  • 1 сентября (19 августа) – св. мученик А.Стратилат (военачальник) и с ним 2593 воина мученически скончались за веру Христову в 302 г.
  • 13 декабря (30 ноября) – св. апостол А.Первозванный.

Приметы:

  • 13 июля – Андрей-наливы: «На Андрея озими в наливах дошли, а батюшка-овес до половины взрос».
  • 1 сентября – А.Стратилат, тепляк. Начало бабьего лета. Ветер, дующий в этот день с юга, обещает хороший урожай овса: «Стратилатов день приспел – овес поспел».
  • 13 декабря на А.Первозванного слушают воду: тихая вода — хорошая зима; шумная – предстоят морозы, бури, метели. Девушки молятся А.Первозванному о даровании хороших женихов.

Нумерологический гороскоп

Числа, влияющие на Андрея, — 2, 4, 6.

Двойка — число контраста, противоборства. Именно оно делает характер Андрея столь непостоянным, мятущимся. Он очень остро реагирует на любые изменения в своей жизни. Внутренние противоречия подчас мешают Андрею разобраться в самом себе и в окружающих людях.

Четыре — число созидания. Оно заставляет Андрея стремиться к надежности и прочности. Как правило, ему трудно находить друзей, но сам Андрей становится щедрым и искренним другом.

Шесть, в данном случае, наделяет Андрея жесткостью в осуществлении своих планов и подчас нетерпимостью к недостаткам окружающих.

Талисманы Андрея

  • Зодиак – Рак
  • Планета – Уран
  • Цвет – сиреневый
  • Благоприятное дерево – пихта
  • Заветное растение – анемон
  • Покровитель – камышовый кот
  • Камень-талисман – аметист

Знаменитости с именем Андрей

  1. Андрей Кончаловский — (род.1937) советский, а затем и российский режиссёр, написал сценарии к 34 фильмам. Является президентом киноакадемии «Ника», обладатель «Серебряного льва».
  2. Андрей, брат Петра, галилеянин, рыбачил на Тивериадском озере (море Галилейском) и входил в общину учеников Иоанна Крестителя.
  3. Андрей Я.Хилков (1676–1718) – князь, знаменитый русский дипломат. Петр Великий отправил его русским резидентом в Швецию (1700), с целью подтверждения Кардисского договора и разведок.
  4. Величайшим художником Древней Руси был Андрей Рублев. Родился в 60-х годах XIV века, умер между 1427 и 1430 гг. Был иноком Троице-Сергиева монастыря.
  5. Андрей Громыко — (1909-1989) советский дипломат, государственный и политический деятель, 28 лет возглавлял МИД СССР) .
  6. Андрей Вознесенский ((1933-2010) советский и российский поэт, был одним из известнейших поэтов 60-х годов ХХ века в СССР.
  7. Андрей Сахаров — (1921-1989) советский физик, участвовал в разработке термоядерного оружия, в дальнейшем стал активно выступать о прекращении его испытания.
  8. Андрей Тарковский — (1932-1986) советский кинорежиссёр, сценарист, известны его фильмы – «Сталкер», «Зеркало», «Берегись! Змеи!», «Солярис», «Ностальгия».
  9. Андрей Макаревич — (род.1953) советский и российский певец, участник рок-группы «Машина времени», активный участник общественной деятельности.
  10. Андреа Бочелли — (род.1958) всемирно известный итальянский тенор, популяризовал оперную музыку, в его репертуаре классические и популярные эстрадные произведения.
  11. Андре Ситроен — (1878-1935) французский предприниматель, создал концерн «Citroеn».
  12. Андрей Боголюбский — (ум.1174) русский правитель, великий князь Владимиро-Суздальского княжества, за 20-летнее правление значительно усилил его позицию.
  13. Андрей Платонов — (1899-1951) советский писатель, свои произведения писал в «нескладной», «первобытной» и «самодельной» натуре.
  14. Андрей Мягков — (род.1938) советский и российский актёр, обладатель различных орденов и наград. Известен своей ролью в фильме «Ирония судьбы, или С легким паром!»
  15. Андрей Аршавин — (род.1981) российский футболист, по различным опросам не раз считался лучшим футболистом России.

Склонение имени по падежам

  • Именительный падеж: Андрей
  • Родительный падеж: Андрея
  • Дательный падеж: Андрею
  • Винительный падеж: Андрея
  • Творительный падеж: Андреем
  • Предложный падеж: Андрее

что значит это имя, и как оно влияет на характер и судьбу человека. Народные приметы, обычаи

Сотни лет назад популярным было поверье о том, что хорошая благополучная жизнь во многом зависит не только от самого человека, но и от того, какое имя родные ему дали при крещении. Считалось, что святые покровители берут деятельное участие в воспитании ребенка, помогают развитию талантов, защищают от жизненных невзгод. Одно из самых популярных имен, которое любят давать ребенку родные – Андрей, значение имени, характер и судьба для мальчиков – эти вопросы родители стараются выяснить заранее.

Значение имени Андрей для мальчика кратко

Один из важных и имеющих немалое влияние в судьбе моментов, которые непременно нужно выяснить заранее – значение имени Андрей для мальчика кратко. Близкие и родные малыша непременно должны знать, что происходит оно из далекой Древней Греции. Тысячелетия назад оно пользовалось у греков немалой популярностью, но, благодаря своему красивому звучанию, быстро распространилось по разным странам. Прошло много лет, но имя имеет успех по-прежнему, и родители с удовольствием дают его своему любимому чаду.

Как трактуется имя Андрей, значение имени, характер и судьба – информации на эту тематику немало. Первое, что можно узнать из специализированной литературы – значение. Это имя имеет всего одно значение, независимо от того, в старинных книгах подана расшифровка или в православных церковных календарях. Означает оно – «мужественный», что немало соответствует действительности. Нередко еще с детства мальчик обирает профессию, которая полностью соответствует значению своего имени – становится военным или спортсменом.

Что означает имя Андрей для мальчика по церковному календарю

Довольно часто родные крохи перед тем, как назвать свое чадо, внимательно изучают, что означает имя Андрей для мальчика по церковному календарю. В православных книгах можно найти немало упоминаний этого имени, ведь один из святых апостолов – Андрей Первозванный, гордо носил именно это имя. Нередко случается, что в его честь близкие люди называют своего малыша, небеспочвенно считая, что этот святой защитит и обережет их любимое чадо в течение всего времени.

Как церковный календарь трактует имя Андрей, значение имени, характер и судьба – полезная информация, которая непременно заинтересует родных мальчика. Значение этого имени не меняется даже в православной литературе – «мужественный». В церковных книгах можно найти немало интересного о том, как великий святой покровительствует мальчику, помогает с выбором жизненного пути.

С самого детства можно ощутить великое покровительство, ведь родные Андрея не будут испытывать затруднений с воспитанием ребенка. Единственное, к чему придется подготовиться заранее – малыш будет стремиться самостоятельно постичь окружающий мир. Нередко придется искать родным мальчика, который, благодаря своей любознательности, может отправиться в самостоятельное путешествие.

Какая тайна имени Андрей должна быть знакома родителям

Имеет ли значение тайна имени Андрей для будущего мальчика? Не следует настраиваться заранее на необычные события в жизни ребенка – ничего такого, что нельзя объяснить, с ним не произойдет. Многие считают, что все это происходит только благодаря высочайшему покровителю, который принимает деятельное участие в жизни мальчика – Андрея Первозванного. Скорее всего, все так и происходит, ведь сложности, трудности и опасности обычно остаются в стороне.

Именно в день именин мальчика (13 декабря) девушки стараются собираться на гадания – принято считать, что именно этот праздник позволяет узнать с высокой точностью свое будущее, предопределить судьбу, принять важное решение. До сих пор эти гадания с нетерпением ожидаются девушками, которые мечтают найти своего суженого – святой непременно в этом поможет.

Происхождение имени Андрей и его значение для детей

Насколько интересно и важно происхождение имени Андрей и его значение для детей? Благодарить за это красивое имя нужно древних греков, которые быстро распространили его по многим странам, где оно стало считаться одним из популярных. Родители, которые мечтали для своих сыновей лучшей жизни, благополучия, успехов на военном поприще, непременно выбирали именно это имя.

Насколько отразится это имя на малыше сразу после крещения? Ничего особого не произойдет, если не считать, что ребенок будет стремительно расти, практически не болея. Даже простудных заболеваний, которые так часто поражают детей, маленький Андрей на себе практически не почувствует. Если родным не удастся уберечь свое любимое чадо от болезни, не нужно заранее паниковать или волноваться – выздоровление придет быстро и без длительного лечения.

С самого детства любопытство малыша принесет родителям немало тревог и волнений – нередко он даже будет сбегать из дома, чтобы познать окружающее, погрузиться в такой манящий и увлекающий мир. Родственникам мальчика придется проявлять наблюдательность, чтобы на прогулках он тоже не отправлялся в самостоятельный путь. Справедливости ради следует упомянуть, что ребенок никогда не будет плакать, потерявшись, а наоборот – воспользуется отсутствием близких людей, чтобы узнать больше об окружающем мире.

Характер мальчика по имени Андрей

Какие черты преобладают у мальчика, и насколько сложным будет характер мальчика по имени Андрей? Уже с детства он начнет отличаться такими достоинствами:

  1. верностью родине и семье;
  2. отзывчивостью;
  3. добротой;
  4. безрассудной смелостью;
  5. умением находить общий язык даже с врагами;
  6. общительностью;
  7. непоседливостью;
  8. веселостью;
  9. заботой;
  10. доверчивостью.

Не следует рассчитывать, что все так радужно, и отрицательных черт у мальчика не будет. Найдутся у него и недостатки, которых не так уж и мало. Один из них – чрезмерная обидчивость. Родителям нужно приготовиться к тому, что придется осторожно подбирать слова, стараясь донести что-либо до своего чада – малейшее неправильное изречение может вызвать у него взрыв эмоций. Конечно же, срываться на родных людях он не будет, но в дальнейшем Андрей непременно постарается избежать воспитательных бесед. Еще один недостаток мальчика – нежелание общаться с людьми, которые ему неинтересны. Даже если это лучший друг, но рассказывает что-то скучное, Андрей может прямо об этом заявить или просто развернуться и отправиться домой.

Судьба мальчика по имени Андрей

Насколько радужной или тревожной будет судьба мальчика по имени Андрей? Будущее сулит немало приятных моментов. По жизни он пройдет с гордо поднятой головой и постоянной улыбкой на губах. Он непременно оправдает доверие родных – будет ласковым и заботливым сыном, верным другом и мужем, ответственным главой семейства.

Выбирая имя ребёнку, родители часто не задумываются о его значении. А ведь оно должно не только красиво звучать. Имя – это судьбоносная линия, фактор планиды. Конечно, в значимость можно и не верить. Но как бы там ни было, факт остаётся фактом. Выбранное имя для мальчика играет важную роль в жизни.

По мнению астрологов, именем Андрей, которое имеет такие значения, как «мужественный» и «храбрый», начали называть мужчин в Древней Греции. После введения в 988 году в Древней Руси христианства это имя распространилось и в русском государстве. Оно пришло из Византийской империи. Интересно то, что сначала именем Андрей нарекали только мальчиков, рождённых в благородных семьях, лишь намного позже так стали называть детей, не принадлежащих к привилегированным сословиям.

Назвав сына Андреем, родители сознательно влияют на его дальнейшую судьбу. Ведь это имя пророчит мужчине такие качества, как реалистичный взгляд, мужественность, позитивный настрой, добросовестность, обаятельность, терпение, аккуратность, ответственность, трудолюбие, исполнительность. Наречённый именем Андрей мужчина всегда является душой компании, так как он способен быстро находить контакт с другими людьми. Такие социально обусловленные компоненты личности помогают Андрею неплохо устроиться в жизни. Многим кажется, что ему даётся всё очень легко. Но это не так. В действительности, чтобы добиться результатов, мужчине приходится прикладывать довольно много усилий, хотя его порой самого берут сомнения, что именно упорство и труд дают плоды. Андрей занижает свою самооценку, его внутренний мир очень сложен. Иногда он становится душой компании, может шутить, острить, играть на гитаре, рассказывать анекдоты или устраивать розыгрыши. В другой же раз он чувствует себя уверенней, когда остаётся в одиночестве.

Работа для Андрея является смыслом жизни. В основном он выбирает профессии, связанные с творчеством. Например, он может быть режиссёром, актёром, композитором, художником, певцом. Андрей хорошо разбирается в технике, но это ему неинтересно, ведь он гуманитарий. Помимо творческой деятельности, мужчина часто занимается точными и естественными науками, из него получается неплохой бизнесмен. Хорошо себя Андрей показывает в таких профессиях, как продавец бытовой и оргтехники, инструктор по вождению автомобилей, преподаватель труда, программист, инженер, учёный, конструктор или менеджер. За профессиональные качества, честное исполнение своих обязанностей и ответственность Андрея ценят коллеги и начальство. Главная задача заключается в достижении карьерных высот, ведь рост в профессии поднимет его авторитет в семье и среди друзей. Но на первом месте стоит материальный достаток.

Довольно часто Андрею хочется всё бросить, будь то служба или семья, и бежать, не оглядываясь назад. Это происходит из-за переутомления, так как мужчина обременяет себя обязанностями, которые не может выполнить. От необдуманных действий его сдерживает чувство долга и ответственность, хотя он тратит на преодоление душевных порывов огромное количество жизненных сил. Чтобы избежать неприятных последствий, нужно просто отдохнуть, отключиться от семейных забот и разного рода дел. Можно съездить на охоту, рыбалку или просто на природу, где и восстановить утраченные силы.

Характер имени Андрей

Мужчина, носящий имя Андрей, всегда такой, каким его хотят видеть окружающие люди. Для матери он ласковый и нежный сын, для товарища – настоящий друг, для жены – огненный любовник, для преподавателя – отличный курсант. Мужчина с удовольствием доставляет людям радость. Если же человек его не интересует, он становится противником. Причём к нему он проявляет неприязнь. Если недруг рассердит Андрея, последствия будут непредсказуемыми. Энергия не позволяет мужчине проявлять терпимость к врагам. Он, быть может, и не покажет вида, но едва ли забудет обиду.

У Андрея довольно противоречивый характер. Он может быть и мягким, и хитрым. Мужчина с таким именем импульсивен, он никогда не будет ничего делать, если ему самому невыгодно, пусть даже этими отказами он причинит боль ближним. Андрей добивается в своей жизни всего, чего хочет, так как способен «пустить пыль в глаза», представить всё в выгодном для него свете. Он расчётлив, эгоистичен, не имеет привычки советоваться, не прислушивается к мнению старших.

Андрей достаточно злопамятен.
Нельзя
его недооценивать
.
Хоть он балагурит и веселится, но в это время всё замечает и запоминает. Мужчина высокомерен, чтобы доказать своё превосходство, он может использовать шантаж либо скандалы. У Андрея есть и такая черта характера, как самокритичность. Это стабильное качество способствует саморазвитию. Он признаёт свои ошибки, но не терпит, когда на них указывают посторонние. Если же ему сопутствует успех, он может быть самоуверенным, заносчивым, тщеславным. Это отталкивает от него людей.

Мужчина с именем Андрей – несомненный лидер, вожак, организатор. Он ведёт за собой людей, преодолевает препятствия, находит выход там, где никто этого сделать бы не смог. Высокая активность в совокупности с силой позволяет добиваться того, что для других недостижимо. Ловкость, удачливость и мгновенная реакция влияют на ситуации, которые Андрей использует с выгодой для себя.

Случается так, что неудача вышибает Андрея из седла. Его охватывает депрессия, опускаются руки. Люди сторонятся мужчину, ведь от жизнерадостного человека мало что остаётся. Но Андрей и в этом случае справляется с неприятностями. Собрав в кулак силу характера, он обращает её против хандры. К нему в качестве подарка возвращается улыбка судьбы и удача.

Имя Андрей для мальчика

Выбирая имя для мальчика, родители предрекают его судьбу. Ведь в переводе с греческого языка это слово обозначает «храбрый». В детстве Андрюша, Андрейка, Андрейчик, Анди, Энди, Дюша (так его называют, пока он маленький) – это спокойный и тихий ребёнок, но в то же время энергичный. Он может бегать по дому, играя в подвижные игры, или в одиночку собирать, например, конструктор, составляя воображаемые предметы. В это время его практически не слыхать, так как он не требует к себе внимания. Маленький Андрей особенно близок к матери, он с ней нежен и ласков. Но вот подчиняться и слушаться не желает, так как очень строптив, капризен и упрям. Мальчик часто спорит с отцом, доказывая свою правоту. Но не стоит заострять на этом внимание. Ведь по натуре Андрей бесконфликтный, усидчивый, терпеливый, целеустремлённый, мечтательный, уверенный в себе. Если у ребёнка есть брат, то он с ним дружит, а вот с сестрой отношения развиваются не лучшим образом. Андрей постоянно с ней конфликтует, ни в чём не уступает.

У мальчика в детстве не очень хорошее здоровье. Он предрасположен к простудным высоко заразным инфекциям. Также у Андрея могут быть проблемы со зрением. Родителям следует обращать внимание на душевное состояние ребёнка, так как частые депрессии и стрессы могут стать причинами серьёзных заболеваний.

Повзрослевший подросток становится положительным по всем направлениям. У него меняется характер. Ему свойственны такие черты, как общительность, трудолюбие, обязательность, доброжелательность, постоянство, добропорядочность, позитивность, внимательность, красноречивость. Но сверстники считают его слишком скучным и нудным, поэтому как таковой дружбы у Андрея с ними не получается. Правда, на него никто не жалуется, да и конфликты между юношами не возникают. Зато позже выясняется, что подросток намного опережает ровесников по развитию, он всего в жизни добивается, дела у него идут успешно. Этого он достигает благодаря аналитическому складу ума, склонности к конструированию и программированию. Гарантами его успеха является целеустремлённость и сосредоточенность.

Но мальчик в подростковом возрасте старается избегать любой ответственности. Из-за обострённого чувства справедливости он часто конфликтует с учителями, которые не понимают, что на него нельзя «давить», нужно просто аргументировать убеждения. Андрей активно участвует в жизни коллектива, поручения выполняет добросовестно.

Андрей в молодости пользуется успехом у представительниц прекрасной половины. Он обладает множеством уникальных качеств, таких как загадочность и обольстительность. Он умеет угадывать желания девушек, поэтому легко завоёвывает женское внимание.

Брак и совместимость имени Андрей

Андрей легкомысленно относится к браку. При выборе спутницы жизни он в первую очередь обращает внимание на внешний вид – женщина должна быть красивой, высокой, элегантной, умной, выдержанной, а её внутренний мир и характер Андрея мало интересует. Главное желание мужчины не любовь, а произведённое впечатление. Правда, с представительницей противоположного пола он внимателен и нежен.

В молодости Андрей довольно непостоянен. Девушек он меняет часто, бывает, что каждый день. Им кажется, что мужчина с ними откровенен, ничего не скрывает, рассказывает о себе всё. Но это не так – Андрей никогда не будет изливать душу, не откроет сокровенные мысли.

Мужчина очень любит комплименты и лесть. Если женщина хочет обратить на себя внимание, она не должна скупиться на красивые слова. Кроме того, Андрей никогда не простит спутнице измены, хотя сам часто ходит «на сторону». Иногда он ревнует жену даже к своим детям, а отношения с матерью супруги довольно напряжённые.

Мужчина с именем Андрей полностью обеспечивает семью, но вот все домашние дела ложатся на плечи жены. Он запрещает ей даже думать о карьере, так как женщина обязана заботиться о нём и детях, быть сексуальной домохозяйкой. Жене надлежит быть более сильной по характеру, она должна ставить перед ним новые цели и задачи. Кроме того, она вынуждена терпеть упрямство супруга и его прижимистость. Импульсивный и непредсказуемый Андрей может преподнести жене очень дорогой подарок, а в следующий раз пожалеть деньги на копеечную вещь для использования в хозяйстве. Для Андрея общественные ценности на ступеньку выше милосердия и доброты, хотя он очень любит свою семью.

Но бывает так, что мужчина не может создать ячейку общества, так как слишком тщательно выбирает женщину по известным только ему характеристикам. Не найдя эмоциональную, внешне эффектную красавицу, в итоге он может всю жизнь провести в одиночестве. Но женившись, Андрей из-за чувства долга никогда не разрушает семью, пусть брак и будет неудачным.

Известные личности

Самым известным человеком, наречённым именем Андрей, является первый ученик центральной личности в христианстве (имеется в виду Иисус Христос) – апостол Андрей Первозванный. После его распятия на кресте в греческом городе Патры появился «Андреевский крест». Его используют в качестве символа на флагах некоторых стран и территорий.

Имя Андрей носят многие выдающиеся личности, оставившие свой след в истории:

  • академик АН СССР, занимающийся теоретической физикой, Сахаров;
  • публицист, художник, архитектор, поэт Вознесенский;
  • живописец, монументалист, педагог Васнецов;
  • кинорежиссёры и авторы многих сценариев: Михалков-Кончаловский и Тарковский;
  • известный и почитаемый русский иконописец московской школы Рублёв;
  • советские актёры: Миронов и Мягков;
  • русский авиаконструктор Туполев;
  • государственный деятель Андрей Громыко;
  • основатель ансамбля «Машина времени», который был создан в 1969 году, Макаревич;
  • футболист Аршавин, являющийся заслуженным мастером спорта России, и другие известные люди.

Это обычный ребенок, который может часами бегать по детской площадке, а, придя домой, собирать конструктор. Найти общий язык с ребенком-Андреем довольно сложно, так как он очень упрям и своенравен. Может капризничать, не слушаться, вести себя невоспитанно. Часто не признает авторитета родителей. И если мать он хоть иногда слушается, с отцом может откровенно конфликтовать. Иногда эта вражда проходит с возрастом, а иногда перерастает в настоящее противостояние. Чтобы этого не произошло, родителям необходимо быть терпеливыми, с пониманием относиться к поведению Андрея и ждать, когда он перерастет свои капризы. В данном случае поведение Андрея может существенно измениться в лучшую сторону.

Андрей не отличается усидчивостью, поэтому, учиться ему довольно сложно. В школе у него часто возникают проблемы с математикой и другими точными науками. Остальные предметы он учит по настроению. Иногда ему бывает просто скучно на уроках, тогда он начинает шалить и проказничать. Из-за этого некоторые учителя могут его недолюбливать. Андрей обладает ярко выраженной склонностью к спорту.
Любит участвовать в командных соревнованиях, дух соперничества пробуждает в нем волю к победе. Но Андрей ненавидит проигрывать. Поражение может настолько разочаровать его, что он потеряет интерес к спорту вообще.

Доверять людям Андрею непросто. Он не любит, когда кто-то знает его слишком хорошо, для него важно сохранять загадочность. Именно эта черта и привлекает к нему девушек. Однако на долгие отношения с Андреем рассчитывать не приходится. Он очень непостоянен и переменчив.
Поддавшись силе чувств, Андрей может сказать своей возлюбленной, что он будет с ней всегда. Но пройдет совсем немного времени, и он клянется в вечной любви и верности другой. Женщина для Андрея – это, прежде всего, красивая игрушка, пусть любимая, но игрушка. Он может баловать ее, заботиться о ней, но, при этом, совершенно не понимать ее и не интересоваться ее внутренним миром. По этой причине брак с Андреем очень часто распадается.

В профессиональном плане Андрей может добиться многого, если захочет. Но ему не хватает самоконтроля, дисциплинированности, ответственности. На работе его часто за это критикуют, однако избежать неприятностей Андрею помогает его обаяние, которым он умело пользуется.

Уменьшительно-ласкательные формы имени Андрей

Андрюша, Андрюшка, Андрюшенька, Андрюня, Андрейка, Андреюшка.

Андрей-Овен

Эмоциональный, часто неспособен контролировать свои чувства. В общении с людьми может быть довольно резок, однако это – всего лишь маска. Такому человеку необходим настоящий друг, который бы принимал его таким, какой он есть.

Андрей-Телец

Человек, ценящий своих родных. Главным в жизни для него является семья, именно там он ищет любовь и поддержку. С другими людьми ему ладить гораздо труднее.

Андрей-Близнецы

Отличается свободолюбием, однако подобное качество в партнере не признает. Любит быть в центре внимания, старается всем понравится. Это иногда приводит к тому, что он становится слишком зависим от чужого мнения.

Андрей-Рак

Карьерист и собственник, стремящийся получить все и сразу. Считает, что знает и понимает все на свете, однако это далеко не так. В личных отношениях склонен к доминированию, из-за чего часто остается один.

Андрей-Лев

Любит нравиться женщинам, но хранит верность своей избраннице. Стремится к долгим, прочным отношениям, мечтает о дружной, счастливой семье. Готов прощать своей возлюбленной многое, ожидая того же от нее самой.

Андрей-Дева

Страдает от неуверенности в себе. Постоянно ждет, что его кто-то похвалит или одобрит. Проще всего ему общаться с детьми. Такие люди становятся прекрасными отцами, отлично понимающими своих детей.

Андрей-Весы

Спокойный и уравновешенный. Свою избранницу любит беззаветно, пытается во всем ей угодить. Может быть мягким, покладистым, пока к нему относятся хорошо и со вниманием.

Андрей-Скорпион

Мечтателен, сентиментален. Нуждается в том, кто бы мог ее поддержать и по-настоящему понять. Влюбчив, раним. Готов на все ради своей возлюбленной, склонен ее идеализировать.

Андрей-Стрелец

Практичный, но, в то же время, может быть романтиком. Ценит и дружбу и преданность, не выносит лжи и предательства. Привязан к родителям, хотя может ссориться с ними по пустякам.

Андрей-Козерог

Усердный, исполнительный. Постоянно недоволен собой, стремится сделать все как можно лучше. Люди часто пользуются его покладистостью, что очень его огорчает.

Андрей-Водолей

Наделен довольно противоречивым характером. Эмоционален, склонен мечтать о несбыточном, рассуждать о жизни. Нуждается в более сильном партнере, способном заставить его поверить в себя.

Андрей-Рыбы

Склонен к меланхолии и даже депрессии. Впечатлителен, раним, уязвим. Ему сложно доверять людям, из-за чего у него может вовсе не быть друзей.

По Хигиру

Основой имени Андрей является корень греческого слова «андрос» — муж, мужчина. Имя имеет немало разновидностей: Анри — у французов, Андрияш — у молдаван, Ондрей — у словаков.

Маленькие Андрюши хитры и мечтательны. Могут долго и увлеченно собирать «Конструктор», но могут и с воплями носиться по квартире, изображая то самолет, то всадника. Непослушны. Любят сладкое, из-за чего с детства портят зубы. Мать слушают по настроению, с отцом пытаются спорить. Если есть брат, дружат с ним и любят его, к младшей сестре относятся ревниво и не уступают ей ни в чем. Андрей-подросток не выделяется ничем, однако позже окружающие вдруг заметят, что он и спортивную школу закончил, и в жизни устроился лучше своих сверстников. Девушки сетуют на непостоянство Андрея: он может с легкостью признаться в любви одной, а на следующий день, не заметив ее, пройти мимо с другой. Его, кажется, ничем не смутишь. Очередной подруге Андрей искренне расскажет о себе все, как на исповеди, но не надо обольщаться этим — всего об Андрее вам никогда не узнать.

Карьера имени Андрей

Среди Андреев есть режиссеры, актеры, певцы, композиторы, художники. Впрочем, одаренность в области искусств в большей степени касается «зимних» Андреев, «Осенние» Андреи, как правило, расчетливы, пунктуальны, не витают в облаках, выбирают профессию в сфере точных и естественных наук. Удачливы в бизнесе. На службе Андрея всегда ценит начальник. Сотрудницы постарше относятся к нему снисходительно, а те, кто помоложе, всегда ждут от него сюрпризов. Никто не знает, что может прийти в голову Андрею в следующую минуту. Импульсивный и непредсказуемый, он может вызвать у жены настоящий восторг редким и дорогим подарком, а потом вдруг заупрямится и доведет ее до бешенства тем, что наотрез откажется купить копеечную вещь, которая давно нужна в хозяйстве.

Любовь и брак имени Андрей

В жены Андрей выбирает красивую, эмоциональную, внешне эффектную женщину, почти не интересуясь ее характером и внутренним миром. Уговоры родственников и предупреждения друзей не торопиться с браком отвергаются. У Андреев высокая самооценка, они эгоистичны и артистичны, требуют повышенного к себе внимания. Могут ревновать жену, если она уделяет много времени ребенку, а мало — ему. Они запасливы, рациональны в материальных тратах. Отношения с тещей обычно складываются сложно.

Им следует быть очень осторожными при вступлении в брак с Варварой, Зоей, Кларой, Нелли, Оксаной, Ольгой, Софьей, Юлией.

Лучше отдать предпочтение девушкам, которых зовут Алевтина, Веста, Данута, Джульетта, Диана, Елена, Елизавета, Ирина, Клавдия, Лариса, Лия, Людмила, Мария, Наталья, Таисия.

Отчества имени Андрей

Независимо от расположения звезд во время рождения Андреи с отчествами Александрович, Абрамович, Игоревич и Олегович тяжелы в общении, обладают сложным характером.

По Менделеву

Яркое, веселое и очень мужественное имя, традиционно любимое в народе — и не только в России. Возможно, это объясняется не так уж часто встречающимся сочетанием признаков «веселый» и «подвижный». Но наиболее заметными у Андрея являются признаки «хороший», «громкий», «могучий» и «храбрый».

Характер имени Андрей

Люди, обладающие именно такими чертами характера, становятся лидерами и ведут за собой других. Они преодолевают препятствия и находят выход там, где никто, кроме них, сделать этого не смог бы. Конечно, временами они жестковаты; в имени Андрей нет весомых признаков «добрый» и «надежный»; пожалуй, средства, которые они выбирают для достижения своих целей, были бы одобрены далеко не всеми. Их активность достаточно высока и в сочетании с силой и мощью позволяет им добиваться того, что для других недостижимо.

Довольно часто носители этого имени — организаторы и вожаки. Они объединяют и ведут за собой, а иногда — просто ловкие и удачливые люди с мгновенной реакцией на изменение ситуации и умением использовать ее с выгодой для себя. Впрочем, они не склонны причинять кому-либо вред и совершать поступки, унижающие кого бы то ни было, — обычно это хорошие люди. Имя Андрей всегда было одним из самых популярных. Десять лет назад, например, по частоте употребления оно делило четвертое и пятое места с именем Дмитрий, лишь немного отставая от Александра, Алексея, Сергея и значительно опережая Владимира.

Основной цвет имени Андрей — зеленый, даже голубовато-зеленый, с красной полосой по краю.

Сексуальный портрет имени (по Хигиру)

Он очень чувствителен, любит лесть, комплименты. С женщинами внимателен и заботлив, это нежный возлюбленный. Перед партнершами не изливается цветистыми комплиментами, но никогда не упустит случая показать им, как он ценит их прелести, — дайте ему возможность вволю поговорить об этом. Его любовным приключениям нет числа. Для Андрея любовь чаще всего является формой самоутверждения в эротической сфере, признанием его сексуальных способностей, которые он может считать развитыми недостаточно.

Сексуальность имени Андрей

Бывает, что сексуальная жизнь Андрея начинается довольно поздно, что его первой женщиной становится его жена и он до свадьбы не осознает полностью своих сексуальных возможностей. Он быстро привыкает к изменениям обстановки, любит доставлять женщине радость даже в ущерб себе, просит ее рассказать о своих желаниях. Во время первой встречи он может быть сексуально активным, но иногда ему хочется просто обнять свою женщину и заснуть рядом с ней. Для того, чтобы проявить высокие сексуальные качества, Андрей должен любить. В любви ему необходима терпеливая женщина, способная понять его сложности и разделить с ним радость, он ненавидит любое проявление грубости со стороны партнерши. Будучи по натуре страстным, он не слишком переживает любовные неудачи (в основном это относится к «зимним» мужчинам).

«Зимний» Андрей не изменяет жене и сам никогда не потерпит не только ее измены, но даже и легкого флирта с другим мужчиной. Он превосходный любовник, полон энергии и бодрости, своим элегантным видом может привлекать красивых женщин.

По Д. и Н. Зима

Значение и происхождение имени: «Мужественный» (греч.)

Энергетика характер имени:
Это имя обладает столь сильной энергетикой, что ее с лихвой хватает на всех в мире Андреев. Андрей-весельчак, Андрей-балагур, заводила, душа компании, часто везунчик, которому удача, кажется, сама идет в руки, – все это привычные образы, сложившиеся в народном сознании. Порою даже сам Андрей не может определить, так это или нет – ведь не все так просто и многое дается ему благодаря тяжелому труду и терпению. Впрочем, чем-чем, а терпением энергия имени наделяет его с избытком.

В то же время в имени ощущаются удивительная трезвость и спокойствие, а потому часто за маской беззаботности в Андрее живет довольно расчетливый наблюдатель. Он, безусловно, не так прост и открыт, как кажется, хотя нередко настолько входит в свою любимую роль жизнерадостного человека, что и в самом деле становится таким. Даже когда ему грустно или тяжело, в общении с людьми Андрей легко находит необходимый заряд бодрости и оптимизма; друзья и знакомые, очарованные благоприятной энергией имени, сами начинают веселить его.

Наверное, поэтому Андрей и не склонен рассматривать тяжелый труд, благодаря которому он достиг своего положения, как некий подвиг. Для него это естественно до тех пор, пока рядом друзья и все удается. Но попробуйте унизить или оскорбить Андрея! Будьте уверены, перед вами встанет совершенно иной человек. Энергия имени не располагает Андрея терпеливо относиться к врагам; быть может, он и смолчит, но едва ли забудет обиду.

Отрицательные черты имени:
Тем не менее у любой силы есть и своя негативная сторона. Часто Андрей бывает ослеплен своими удачами и ему начинает казаться, что всего в жизни он достиг благодаря собственным усилиям. В этом, конечно, есть доля истины, но если бы только в жизни все зависело исключительно от личных стараний! Может случиться так, что серия неудач вышибет Андрея из седла и разочарование в собственных силах будет столь велико, что у него опустятся руки. В этом случае от жизнерадостного Андрея мало что останется, люди начнут сторониться его, перестав оказывать поддержку. Тогда уже удачи ему долго не видать, а депрессия день ото дня будет усиливаться.

Чтобы избежать столь неприятного оборота, Андрею надо всего-навсего обратить силу своего характера против этой хандры. Сумев спокойно отнестись к неудачам и вернув жизнерадостную улыбку на лицо, Андрей может быть уверен – ответная улыбка Судьбы не заставит себя долго ждать и люди с радостью помогут ему в любых его делах! Ну а пока будет так, Андрей добьется успехов практически в любой области, исключая разве что бюро похоронных услуг, где его жизнелюбие вряд ли окажется уместным.

Секреты общения: С Андреем не только легко общаться, но также можно и поспорить. Вот только не советуем переходить в спорах на личности, если, конечно, вы не хотите заполучить довольно сильного врага. Он, скорее всего, охотно откликнется на вашу просьбу о помощи, тем не менее советуем вам все же знать в этом меру.

След имени в истории:

Андрей Макаревич

Из чего состоит портрет человека? Из его прошлого, настоящего или перспектив? Из мировоззрения, работы или увлечений? Или из всего по чуть-чуть, как из разноцветных кусочков мозаики? Но как быть, когда в чьей-то жизни таких кусочков набирается слишком много? Тогда ничего не остается, как, отсеив второстепенное, остановиться на самом главном. А главное, без соменния, то, что Андрей Макаревич, — это живая легенда русского рока, бессменный лидер группы «Машина времени», философ, певец, музыкант. Его философия — не в интервью на страницах газет, не в кулинарных откровениях, не в занятиях подводным плаванием, изобразительным искусством, бизнесом. Она в его песнях и в образе жизни, который совмещает в себе все эти несовместимые компоненты и толкает в новые области, на покорение новых вершин.

Пожалуй, одна из главных движительных сил Макаревича — это его любознательность, которая поистине не не знает границ. Что еще могло заставить человека пытаться проникнуть в суть чуть ли не всех предметов и явлений, будь то законы Вселенной, законы моря, законы успеха или законы солянки? Что же касается самого Макаревича, то он немалую роль в своей жизни отводит интуиции, в том числе, своим снам. «В детстве меня часто преследовал один и тот же сон: будто бы я с родителями катаюсь на лодке по озеру, как вдруг вываливаюсь за борт спиной вперед и тут же ухожу под воду. Много лет спустя, находясь под водой с аквалангом и глядя наверх, я поразился, насколько тогда, во сне, я видел точную картину».

При всех своих разносторонних интересах, к политике Андрей Макаревич относится с холодным любопытством, как к явлению непостижимому: «Я могу понять, когда человек с детства мечтает стать пожарным или космонавтом. А вот когда он становится политиком? Мне это страшно интересно. Потому что в детстве все наверняка были нормальными людьми».

Имя Андрей произошло от древнегреческого слова «Андрос», что в переводе означает «мужчина», «человек». От него произошло имя Андреас, которое на Руси переименовалось в Андрея – «храбрый», «мужественный», «смелый». После принятия христианства имя стало распространяться и на Руси, до этого оно было известно только в Византии. В те времена Именем Андрей называли только отпрысков благородных семей, затем имя распространилось и среди простого народа. В советское время пик популярности пришелся на 70-е годы прошлого столетия, когда Андреями называли каждого четвертого новорожденного мальчика. На сегодняшний день имя так же популярно, как и несколько столетий назад.

За долгие века энергетика имени Андрей стала только сильнее. Множество выдающихся личностей, с интересной судьбой и талантами, носящих это победоносное имя — прямое тому доказательство. Андрей — очень непредсказуемый человек. Никто не может поручиться за то, какой он шаг сделает в следующую секунду. В Андрее сочетаются такие качества как трезвый расчет и расточительность, спокойствие и эмоциональность, серьезность и веселость, при этом важно, в какое время года был рожден носитель данного имени.

Характеристика имени Андрей

Соответствующий знак Зодиака
: Скорпион ♏.

Покровительствующая планета
: Венера ♀.

Доминирующая стихия Фен-шуй
: Дерево 木.

Талисман-камень, минерал, металл
: Аметист.

Талисман-цвет
: Сиреневый, Желтый, Коричневый.

Талисман-дерево
: Клен 🍁.

Талисман-растение
: Анемон.

Талисман-животное
: Камышовый кот.

Наиболее удачный день
: Суббота ♄.

Счастливое время года
: Осень 🍂.

Особенности характера
: Трудолюбие, Решительность, Терпеливость, Непостоянство, Тщеславие.

Весенний Андрей
отличается легкомыслием и беспечным отношением к жизни. Его великодушие никого не оставит равнодушным, поэтому у него много друзей. А вот второй половинке летнего Андрея придется несладко, ведь он жаждет приключений и развлечений, тогда как заботы о содержании семьи его мало интересуют.

Летний Андрей
– настоящий весельчак и балагур, которому рады в любой компании, ведь его смешные истории и прекрасное чувство юмора всем поднимают настроение. Благодаря своему легкому характеру и жизнелюбию он пользуется повышенным вниманием у женщин.

Осенний Андрей
обладает аналитическим складом ума, он пунктуален, дисциплинирован и привык выстраивать свою жизнь по четко составленному плану, в котором нет места случайностям. Неудивительно, что он тяготеет к точным, а также естественным наукам, что впоследствии помогает ему стать успешным предпринимателем.

Зимний Андрей
– творческая личность, которая найдет себя на поприще режиссера, актера, певца, поэта или художника. Он справедлив, но при этом мягок, не приемлет лжи и равнодушия. Из-за мягкого характера и принципиальности часто наживает врагов, поскольку яростно отстаивает свои убеждения. В отношениях с девушками зимний Андрей обаятелен, обходителен и романтичен.

Характер имени Андрей

Тайна имени раскрывается при знакомстве с Андреем. По своей природе это веселый и жизнерадостный человек. Одиночество не для него. Любит шумные компании, практически всегда находится в центре внимания. Отзывчив, всегда спешит прийти на помощь друзьям. Родные и близкие купаются в его ласке и внимании. Своим обаянием может покорить практически каждого.

Андрей — самокритичный, уравновешенный человек, который должен держать все под контролем. Знает себе цену, но часто имеет завышенную самооценку. Любит, чтобы ему уделяли много внимания. Не терпит конкуренции. Легко может выйти из себя, если кто-то другой вместо него вызовет больше заинтересованности в компании.

Положительные черты имени Андрей
: Легкость в общении, веселый нрав, душевность, трезвый расчет, упорство и настойчивость в достижении цели. Андрей умеет защитить свои интересы и интересы дорогих ему людей. Он честен, даже благороден, ищет справедливости. Андрей может покровительствовать, помогать, участвовать в решении проблем других людей, но не безоглядно, а до определенного предела.

Отрицательные черты имени Андрей
: Перепады в настроении, ранимость, чувствительность, нетерпимость к обидчикам, мстительность, язвительность. Ему внезапно может все надоесть и наскучить. Удачливый Андрей самоуверен, заносчив, забывает о тех, кто помог ему достигнуть успеха. Он высокого о себе мнения, горд, эгоистичен, требует к себе повышенного внимания, часто непредсказуем в своих действиях. Неудача в жизни может привести Андрея к депрессии, унынию, бездействию, моральному разложению.

Увлечения и хобби

Увлечения Андрея разносторонние и порой несовместимые. Это творческая личность. Он может заниматься боксом или единоборствами, а может увлекаться философией, музыкой, актерским мастерством, писать стихи и прозу, рисовать.

Профессия и бизнес

Андрей — очень трудолюбивый человек. Часто считает, что всего добился сам, и это отчасти является правдой. Высокая самооценка Андрея и его уверенность в себе, несомненно, способствуют карьерному росту. Если же добавить к этим качествам добросовестность и исполнительность, то становится понятно, почему он пользуется уважением у начальства. С подчиненными и коллегами Андрей тоже отлично ладит, а все благодаря обаянию, чувству юмора и умению подобрать к каждому человеку нужный ключик. Артистичность Андрея и его стремление быть всегда в центре внимания найдут выход в творческих профессиях (из Андрея получится хороший актер, композитор, художник, певец, писатель или режиссер). Отзывчивость и добродушие носителей этого имени как нельзя кстати придутся в профессии спасателя, пожарного или врача. Но Андрей – не альтруист, а потому профессию будет выбирать такую, которая сможет принести ему финансовую стабильность и независимость. Немаловажным фактором для него является и престижность выбранного поприща.

Практичность Андрея и его рациональность способствуют тому, что он добивается больших успехов в предпринимательской деятельности. Он не любит рисковать, а все свои действия продумывает на несколько ходов вперед, поэтому заранее знает исход того или иного предприятия, той или иной сделки. При этом свой бизнес он ведет честно, за что его уважают партнеры.

Психика и здоровье

Чаще всего носители имени Андрей обладают холерическим типом мышления. На первый взгляд Андрей производит впечатление оптимистичного, открытого, веселого, простого и жизнерадостного человека, но не стоит доверять первому впечатлению. На самом деле Андрей редко открывает свою душу людям, поскольку очень тяжело переживает обиды и предательства. Его нельзя открыто критиковать и сомневаться в его способностях. Стимулировать его лучше похвалой и поощрением. По отношению к своим врагам Андрей непримирим, поэтому лучше сто раз подумать перед тем, как вступать с ним в конфронтацию.

Здоровье Андрея достаточно крепкое, но охлаждения и сырого климата ему лучше избегать, так как он расположен к заболеваниям органов дыхания. А вот своему душевному состоянию Андрею следует уделить особое внимание, поскольку стрессы и депрессии могут стать причиной развития многих других заболеваний. Андрею нужно выработать в себое стойкий оптимизм, чтобы преодолевать депрессию, которая иногда будет охватывать его. Главной заботой в области здоровья должна быть психологическая релаксация, очень важно устранение нервного напряжения.

Любовь и секс

Непостоянство Андрея проявляется в личной жизни: несмотря на свою нравственность, до момента вступления в брак он не отличается постоянством, обосновывая это тем, что должен выбрать самую лучшую женщину, которой посвятит всю свою жизнь. Такое поведение приводит к тому, что представительницы прекрасной половины человечества обижаются на Андрея. Андрей крайне избирателен в выборе своей возлюбленной, которая просто обязана быть красивой, эффектной, умной, заботливой и эмоциональной. А вот внутренний мир любимой женщины интересует Андрея мало, поскольку основная ее задача – боготворить своего суженого, создавать уют и комфорт. Он всегда нежен и внимателен, однако чаще всего им руководит не чувство любви, а желание выглядеть в глазах женщины рыцарем и благодетелем.

В сексуальной жизни Андрей крайне восприимчив и чувствителен, он любит лесть, комплименты, а также повышенное внимание. Женщинам он готов дарить нежность и страсть, но лишь при условии, что они будут платить ему сторицей. Интересно то, что такие понятия как любовь и секс для Андрея неделимы, поэтому он не будет тратить ни своих душевных, ни физических сил на женщину, к которой не испытывает хотя бы чувства влюбленности. Дело в том, что для Андрея даже любовь является некой формой самоутверждения в сексуальной сфере и признанием его недюжинных способностей. Андрей может всецело отдаваться сексуальным утехам, а может захотеть отдохнуть от активной интимной жизни. Поэтому ему нужна терпеливая и понимающая женщина, которая сможет мириться с такими перепадами настроения Андрея. В своей партнерше он не потерпит грубости и отсутствия женственности.

Семья и брак

Андрей ценит семейные отношения. В жены он выбирает красивую и эффектную женщину (зачастую именно внешность становится решающим фактором при выборе супруги), которая обязательно должна нравиться его знакомым и друзьям (жена становится некой визитной карточкой Андрея). При этом нельзя не сказать о том, что Андрей все же женится по любви, но если его жена не будет соответствовать его высоким «стандартам», то он может увлечься другой женщиной. Интересно то, что измены свои он тщательно скрывает, продолжая играть роль примерного семьянина (развод для Андрея равносилен признанию его несостоятельности как настоящего мужчины).

Андрея тяжело назвать хозяйственным человеком (для этого у него есть жена, на плечи которой ложатся все бытовые проблемы), при этом он считает себя полноправным главой семейства, основная задача которого заключается в обеспечении семьи материальными благами. Поэтому рядом с Андреем уживется лишь заботливая и нежная женщина, готовая забыть о своей карьере и посвятить свою жизнь безраздельно своей семье. Эгоистичный и ревнивый Андрей требует к себе максимум внимания, поэтому вполне может ревновать жену к ребенку.

Гороскоп имени Андрей

Андрей-Овен ♈
– это достаточно неуравновешенная личность, подверженная частой и резкой смене настроения. Андрей-Овен может проявлять агрессию по отношению к окружающим, но такое поведение является лишь защитной реакцией, за которой скрываются ранимость и обидчивость. Андрею, рожденному под знаком Овна, нелегко найти общий язык с противоположным полом.

Андрей-Телец ♉
– неуверенность в себе и болезненное восприятие критики в свой адрес способствуют тому, что Андрей-Телец часто замыкается и отгораживается от социума. У него мало друзей, которые способны принять его таким, какой он есть. Для Андрея-Тельца самое важное – это семья, в которой он должен чувствовать заботу и поддержку.

Андрей-Близнецы ♊
– это человек с очень развитым воображением, поэтому ему легко найти себя в любой сфере и сойтись с любыми людьми. Недостаток его состоит в том, что он слишком зависит от мнения окружающих, что мешает ему проявить себя и свои возможности в полной мере. Андрей-Близнецы – свободолюбивая натура, но своей избраннице он свободу ограничивает.

Андрей-Рак ♋
– острый ум и прекрасная память помогают Андрею-Раку достичь невероятных успехов в работе. Он твердой поступью идет к намеченной цели, и никакие преграды не в силах его остановить. Его чувство собственничества распространяется не только на возлюбленную, но и на друзей.

Андрей-Лев ♌
– благородство, честолюбие и тщеславие – вот основные характеристики Андрея-Льва, привыкшего всегда и во всем быть лучшим. Эти качества помогают ему сделать прекрасную карьеру. Он нравится женщинам, но, выбрав ту единственную, не станет ей изменять, ведь семья у него стоит на первом месте.

Андрей-Дева ♍
– это неуверенный в себе человек, который ко всему относится недоверчиво и настороженно. Андрей-Дева испытывает внутренний страх перед принятием серьезных решений, поэтому ему нужна женщина, которая сможет подарить ему максимум тепла и любви, поддержит во всех его начинаниях.

Андрей-Весы ♎
– это серьезная, прагматичная и обстоятельная натура, для которой важны морально-этические аспекты жизни. Андрей-Весы – преданный муж, любящий отец, добросовестный работник. Его слова никогда не расходятся с делом.

Андрей-Скорпион ♏
– сентиментальный мечтатель, последний романтик – так можно охарактеризовать Андрея-Скорпиона, который все принимает слишком близко к сердцу. Ему свойственно проявлять и такие качества как капризность, упрямство и агрессию, поэтому его второй половинке надо набраться терпения и понимания.

Андрей-Стрелец ♐
– это покоритель женских сердец, в жизни которого одно любовное приключение сменяется другим, при этом всех своих женщин Андрей-Стрелец искренне любит, но и остывают его пылкие чувства очень быстро. Лишь оригинальная и необычная женщина может удержать возле себя такого казанову.

Андрей-Козерог ♑
– это трудолюбивый, упорный и крайне сознательный человек, который готов трудиться 24 часа в сутки ради достижения своей цели и благосостояния своей семьи. В жены Андрей-Козерог выбирает хозяйственную и домашнюю женщину, которая сможет стать для него настоящим тылом.

Андрей-Водолей ♒
– это мягкий, добродушный и чувственный человек с богатым воображением, который склонен идеализировать людей (поэтому часто Андрей-Водолей разочаровывается в людях, которые в итоге не отвечают его высоким идеалам). Крепкий союз возможен лишь с сильной и уверенной в себе женщиной, знающей себе цену.

Андрей-Рыбы ♓
– жизненные трудности могут привести робкого, уязвимого и впечатлительного Андрея-Рыбу к нервным срывам. Он с пониманием относится к окружающим людям, которым всегда готов помочь. Его любят дети и жена, которых он просто боготворит.

Совместимость имени Андрей с женскими именами

Андрей и Ольга
– это творческий союз, который строится на общих интересах, причем эти интересы могут быть как личными, так и деловыми. Но следует остерегаться определенной легкомысленности в отношениях, которая может поставить под сомнение доверие между партнерами Андреем и Ольгой.

Андрей и Анна
– очень интересная пара, которая может показаться странной, ведь Анна и Андрей далеки от реалий современного мира, в котором правят деньги и власть. Они сосредоточены друг на друге и на саморазвитии, но все же забывать о действительности не стоит, иначе отношения не сложатся.

Андрей и Елена
– и Андрей, и Елена не приемлют общепринятых норм, особенно если они не соответствуют их идеалам. Поэтому данный тандем в обществе часто не воспринимается всерьез, но пару это нисколько не смущает, ведь они живут своей обособленной жизнью, в которой им хорошо вместе.

Андрей и Юлия
– в этой паре не знают, что такое скука или тоска, ведь они оптимистично смотрят в будущее, строя общие планы. Страстную Юлию манят новые вершины и горизонты, которые они осваивают и покоряют вместе, тем самым наполняя свои отношения новой энергией.

Андрей и Анастасия
– этот крепкий союз основан на доверии, почитании традиций, трудолюбии и целеустремленности обоих партнеров. Любовь между Андреем и Анастасией – это симбиоз нежности, дружбы и доверия. А вот страсти в этих отношениях не хватает, что со временем может негативно сказаться на интимной стороне жизни.

Андрей и Татьяна
– дух приключений объединяет Андрея и Татьяну, их манят перемены и новые открытия. Несомненно, такой авантюризм не даст паре заскучать, но отсутствие стабильности может негативно отразиться на семейной жизни, особенно, когда у пары появятся дети.

Андрей и Екатерина
– принципиальность, стремление к лидерству и властность как объединяют партнеров (если Андрей и Екатерина будут вести совместный бизнес, то успех им гарантирован), так и разъединяют (часто партнеры начинают борьбу за власть в семье). Только терпение и понимание помогут сохранить этот союз.

Андрей и Наталья
– это далеко не гармоничный и не легкий брак, в котором женщина живет эмоциями, а мужчина – трезвым рассудком. Наталье хочется больше свободы, тогда как эгоистичный Андрей не готов идти на уступки своей возлюбленной.

Андрей и Ирина
– это прочный союз, в котором царят взаимопонимание, поддержка, любовь и абсолютное доверие. Ирина не стремится брать на себя роль главы семейства, напротив, она с удовольствием подчинит свою жизнь интересам семьи. Андрей любит и ценит свою супругу.

Андрей и Мария
– в этой паре оба партнера умеют радоваться жизни, при этом свои силы они предпочитают тратить на достижимые цели, а не на иллюзорные мечты. Андрей и Мария предпочитают не ссориться по мелочам, а решать все проблемы за столом переговоров, что помогает им сохранить нежные чувства.

Андрей и Светлана
– это очень благополучный союз, в котором удача сопутствует Андрею и Светлане во всем. Любовь, слава, богатство являются составляющими такого брака (главное – научиться не только получать от судьбы дары, а и отдавать их часть тем, кто в этом нуждается).

Андрей и Марина
– их отношения – пример для подражания. Андрей и Марина – инициативные и активные люди, которые постоянно пытаются привнести в совместную жизнь что-то новое и интересное, дабы быт не разрушил тех нежных и пылких чувств, на которых и основывается их брак.

Андрей и Кристина
– в этом тандеме Кристине отведена роль оратора, а Андрею – слушателя, при этом обоим такая позиция абсолютно подходит. Они не ссорятся и не конфликтуют, поскольку Андрей снисходительно относится к проявлению лидерства своей избранницы.

Андрей и Виктория
– несмотря на то, что союз между Андреем и Викторией может быть продолжительным, прочным его назвать нельзя. Когда страсть проходит, оба партнера живут по принципу «стерпится — слюбится», вместе их удерживают совместный быт и дети.

Андрей и Ксения
– такие отношения основываются на страсти и яркости, но независимость и свободолюбие обоих партнеров часто приводят к ссорам, в которых истина не рождается, а, напротив, теряется. Если Андрей и Ксения не научатся уступать друг другу, их брак обречен.

Андрей и Любовь
– схожесть характеров Андрея и Любы помогает им лучше понять друг друга. Они ценят свои отношения, к которым относятся очень трепетно. Их рациональность и практичность помогают сохранить отношения там, где более эмоциональная пара не смогла бы этого сделать.

Андрей и Яна
– и для Андрея, и для Яны брак – ответственный шаг, к которому они идут не один год, проверяя друг друга в различных ситуациях. Поэтому союз их зачастую очень прочен, поскольку партнеры прекрасно знают сильные и слабые стороны друг друга и умеют с ними мириться.

Андрей и Надежда
– в этой паре партнеры всецело концентрируются друг на друге и на своих отношениях, которые они выстраивают медленно, но уверенно. Надежде и Андрею не свойственны чрезмерная импульсивность и порывистость, что благоприятно отражается на их совместной жизни, в которой конфликты решаются на стадии возникновения.

Андрей и Алина
– внимательный Андрей любит Алину и боготворит ее за женственность и нежность. Алина ценит в своем партнере заботу и умение отстаивать свои интересы. Но карьерист Андрей может потерять семью, если не будет уделять ей должного внимания.

Андрей и Диана
– такие независимые индивидуальности как Андрей и Диана могут создать прекрасный партнерский тандем, тогда как в семейной жизни их амбиции и бескомпромиссность могут помешать построению крепких отношений.

Андрей и Евгения
– это очень прочный союз, в котором партнеры стараются удивлять друг друга, дарить новые эмоции, подпитывающие чувства. Андрей и Евгения любят путешествовать, причем рождение детей не мешает им странствовать. Это активная семья, в которой редко случаются конфликты и недопонимание.

Андрей и Дарья
– эту пару можно назвать идеальной, ведь цель обоих – создать крепкую семью, в которой царят гармония и понимание. Андрей и Дарья не борются за лидерство, предпочитая равноправие в отношениях.

Андрей и Олеся
– преданность, любовь, страсть – вот основа отношений Андрея и Олеси. Они умеют находить новые краски в обыденных вещах, что помогает им каждый день открывать новые грани друг друга.

Андрей и Алена
– это гармоничные отношения, в которых сексуальной жизни отводится одно из ведущих значений. При этом страсть между Андреем и Аленой не только не остывают, а, напротив, воспламеняются. Главное в этой паре – не допустить войны межличностных интересов.

Андрей и Маргарита
– чуткая Маргарита любит находиться в центре внимания, она эффектна и красива, что не только манит Андрея, но и постоянно поддерживает его интерес к своей партнерше. И здесь важно, чтобы Маргарита не заигралась с чувствами Андрея.

Андрей и Александра
– в паре Александры и Андрея нет места бурной страсти, поэтому и эмоциональных выяснений отношений между ними практически не бывает. В этом союзе царят разумный подход и практичность, но и нежности в них тоже есть место.

Андрей и Людмила
– это очень сложные отношения, в которых на первое место выходит не любовь, а упрямство партнеров, которое проявляется и в быту, и в семейной жизни, и в интимных отношениях. Если Андрей и Людмила смогут побороть это качество, то союз их будет ярким и длительным.

Андрей и Галина
– новизна и постоянное движение – вот основа союза между Андреем и Галиной, которые любят общение, приключения, перемены. Не достает этой паре лишь стабильности, а это немаловажно для настоящей сплоченной семьи.

Андрей и Полина
– в этой паре нет места эгоизму, ведь Андрей и Полина строят свой союз на любви, нежности и заботе, что помогает им преодолевать все трудности, встающие на их пути. Поставленных целей они добиваются вместе, поддерживая друг друга в любых начинаниях.

Андрей и Карина
– эти отношения больше напоминают взаимовыгодное партнерство, чем брак в традиционном понимании. Но от этого союз Андрея и Карины не становится менее прочным и продуктивным, но при условии, что обоим подходит подобный формат отношений, в которых нет пылкой страсти.

Андрей и Инна
– в этом союзе есть все: любовь, нежность, масса положительных эмоций. Нет лишь стабильности, которая просто необходима для создания крепкой семьи. Поэтому брак Андрея и Инны редко длится долго.

Андрей и Валерия
– авантюризм и желание перемен руководят этой парой, для развития отношений в которой жизненно необходимы эмоциональные всплески. Новые знакомства, новые места, новые впечатления способны вновь и вновь воспламенять чувства Андрея и Валерии.

Андрей и Алла
– это союз, в котором нет места обыденности, причем часто это отрицательно сказывается на взаимоотношениях Андрея и Аллы. Они умеют страстно любить и пылко ненавидеть, быть нежными и агрессивными. Чрезмерная эмоциональность партнеров приводит к тому, что в конечном итоге пара распадается.

Андрей и Елизавета
– эти непохожие люди прекрасно чувствуют себя в обществе друг друга, но разные жизненные ориентиры могут стать для Андрея и Елизаветы непреодолимым препятствием на пути к счастливой семейной жизни.

Андрей и Вероника
– это очень перспективный союз, объединяющий двух жизнелюбивых и энергичных людей, которые могут превратить свою жизнь в настоящий праздник. К тому же Андрей и Вероника – прекрасные любовники, что немаловажно в семейной жизни.

Андрей и Валентина
– если в паре Андрея и Валентины присутствует любовь, то союз их будет крепким и долгим, в противном случае отношения может разрушить измена партнера, для которого такие понятия как секс и любовь неразрывно связаны.

Андрей и Лилия
– эти двое обладают схожими характерами, что может как сближать их, так и отдалять. Все зависит от способности понимать друг друга, идти на уступки и смотреть в одну сторону. В целом Андрею и Лилии есть чему поучиться друг у друга.

Андрей и Лариса
– это страстный союз, в котором Андрею и Ларисе комфортно не только в интимной жизни, а и в быту. Эмоциональная Лариса умеет поддержать и приободрить рассудительного Андрея, к тому же оба они готовы идти на компромиссы.

Андрей и Тамара
– серьезной и требовательной Тамаре комфортно с весельчаком Андреем, который способен превратить жизнь своей избранницы в настоящее приключение. И здесь важно, чтобы Тамара научилась более легко относиться к жизни, иначе Андрею наскучит монотонная семейная жизнь.

Андрей и Антонина
– независимые Андрей и Тоня не спешат вступать в брак, и чем больше они оттягивают этот момент, тем меньше у них шансов на создание семьи. В целом свободолюбие обоих партнеров не располагает к крепкому союзу.

Андрей и Ангелина
– это союз людей, которые хотят получать от жизни все и сразу, их жизнь должна напоминать бесконечный праздник, при этом возвращение к реалиям нагоняет на них тоску. Отсутствие романтики и новизны могут привести к разрыву отношений между Андреем и Ангелиной.

характеристика и совместимость парня в любви, рожденного в год Быка, какая женщина по знаку зодиака ему нужна

Знакомясь с человеком и вступая с ним в отношения, многие стремятся как можно больше узнать о его характере, привычках, увлечениях, взглядах на мир. Это помогает найти точки соприкосновения с тем человеком, который дорог. Нередко помощником в этом может стать гороскоп. Если знать год рождения и созвездие, под которым родился человек, можно выяснить очень многое. Например, какими качествами обладает мужчина Скорпион, рождённый в год Быка, что говорит о нем характеристика и какова совместимость с другими знаками зодиака.

Основная характеристика

Мужчина Скорпион-Бык с первого взгляда – идеал и мечта любой женщины. Смелый и сильный, ничего не боится, не пасует перед трудностями. Не растеряется в сложных и непредсказуемых ситуациях и всегда быстро найдёт решение. Благодаря своей твёрдости характера и силе воли способен добиться любых высот, причём будет идти по выбранному пути, невзирая на препятствия, пока не добьётся своей цели.

У такого мужчины богатый внутренний мир, он много знает, читает; можно сказать, что отличный психолог, очень хорошо разбирается в людях; его сложно обмануть – быстро почувствует ложь и потеряет интерес к такому человеку. Эту интуицию даёт знак зодиака Скорпион. А рождённый в год Быка, ещё получает необычайную силу и выносливость. Поэтому характеристика и выглядит так, словно речь идёт о супергерое. Во многом так и есть. Именно эти качества и влекут к нему людей, особенно женщин.

И в дружбе, и в любви честен и порядочен. Другу всегда подставит плечо и будет с ним до конца в самых сложных ситуациях. Такого мужчину часто даже не надо просить о помощи – он сам чувствует, когда она необходима и всегда появляется в нужный момент. Причём, помощь может быть самая разная, как физическая, так и моральная. За эти качества очень ценят друзья. Почти всегда может дать чёткую и правильную оценку событиям, а потому советы всегда являются дельными, к ним лучше прислушаться.

Женщину такой мужчина привлекает самым главным качеством – надёжностью. Именно с ним можно чувствовать себя, как за каменной стеной. На него можно положиться в любой ситуации. Кроме того, чаще всего Скорпион-Бык очень обаятелен, умеет подержать разговор и заинтересовать собеседника. Обладает уникальной чертой – всегда оставлять какую-то загадку, что ещё больше притягивает к нему. До конца раскрывается крайне редко. И если не встретит достойного человека, может не раскрыться вовсе. Зато окружающие с лёгкостью доверяют ему свои тайны. И это они могут делать без всякой боязни. Скорпион-Бык умеет хранить тайны, тем более, если доверили что-то сокровенное. Не склонен к сплетням и интригам. Если разочаровывается в человеке, объяснять ничего не будет, просто уйдёт.

В работе проявляет себя как натура деятельная. Сидеть на месте не может, ищет постоянного развития. Очень сильно развито чувство долга, поэтому Скорпиону-Быку можно доверить самую ответственную и сложную работу, она будет выполнена с высоким качеством. Чаще эти люди выбирают экстремальные виды деятельности. И если работа никак не связана с риском, они получают адреналин в других областях, выбирая их своими увлечениями. Становясь начальником, придерживается тех же принципов: любая работа должна выполняться качественно и в срок; того же он требует от своих подчинённых.

Отношения с женщинами

Женщин вокруг него всегда много, но те, кто слишком активно добиваются его внимания, не вызывают интереса. Легкодоступные женщины его не привлекают. Он – завоеватель и победитель. Эти качества распространяются и на отношения с женщинами. Скорпиону-Быку нужна именно та, которую он выбрал сам и готов добиваться её любыми путями. Это не тот человек, который ориентируется на внешнюю яркую упаковку, для него важна суть. Поэтому ему нужна женщина с высоким интеллектом, образованная и начитанная; соратница, которая должна разделять интересы и относиться с пониманием к увлечениям и внутреннему миру. Ценит в женщине чувство юмора, лёгкость, честность и искренность. Этому мужчине очень важно, чтобы, кроме любви и страсти, присутствовали ещё и дружеские, очень доверительные отношения.

В любви верен, и если выбрал себе в спутницу женщину, будет с ней до конца. Если чувства пройдут, удержать его не удастся, да Скорпион-Бык и сам не будет врать и изворачиваться, во всём признается честно. Предательства и измены не простит ни за что и ни при каких обстоятельствах. Женщине, выбравшей в мужья такого человека, следует всегда об этом помнить и вести себя достойно. Скорпиону-Быку нужно всё или ничего, довольствоваться какой-то частью не будет. Нужно это чётко понимать. При любом неверном шаге назад дороги уже не будет.

Брак для него не имеет смысла без детей, они для него очень важны. При самой большой занятости всегда стремится уделить детям время, это очень хороший отец. Для мальчика это замечательный пример и даже идеал, к которому нужно стремиться. Такой отец сможет воспитать из мальчишки настоящего мужчину. Для девочки это самый лучший и любимый мужчина. Его черты характера она потом ищет и в своих избранниках. Если семья рушится, Скорпион-Бык никогда не оставляет детей, они для него так и остаются самыми главными людьми, он берёт на себя ответственность и заботится о них.

Если женщина доверится мужу и отдаст бразды правления в его руки, то будет счастлива. Он может быть только лидером, по-другому не получится. И если женщина будет пытаться с ним соревноваться, это будет вызывать конфликты и споры. Чтобы этого избежать, следует уступить; тем более ума и интуиции мужа всегда хватает, чтобы принимать правильные решения. Женщине остаётся только заниматься домашним очагом, детьми и своими делами. Во всех начинаниях муж обязательно поддержит и даст хороший совет.

Спутницу Скорпион-Бык ищет очень долго, ведь у него очень высокие требования, и если не найдёт, может вообще не жениться. Но семью создать стремится, поскольку ценит уютный очаг, хочет, чтобы рядом были дети, любящая женщина. Если в сердце так и не вспыхнет любви, в более зрелом возрасте выбирает спутницу, которая соответствует определённым требованиям и в которой он видит будущую мать своих детей.

Совместимость с другими знаками зодиака

  • Если брать во внимание символ года, то комфортнее всего такому мужчине с женщиной, рождённой в год Быка. Они удачно дополняют друг друга, в отношениях царят взаимопонимание и гармония. Брак может быть практически идеальным, если оба к этому будут стремиться.
  • Дракон, Крыса и Свинья тоже вполне подходящие партнёры. Есть шанс построить хорошую семью, но придётся обоим идти на небольшие уступки.
  • Петух, Змея и Кот – те символы, на которых тоже не стоит ставить крест. Если возникли чувства, почему бы не попробовать. Шансы на хорошие взаимоотношения неплохие.
  • Того же самого, к сожалению, нельзя сказать о Собаке, Лошади и Обезьяне, Тигре и Козе. Здесь будет сложно построить отношения, в итоге всё равно такой союз обречён на неудачу, как бы ни старались партнёры.
  • Если говорить о знаках зодиака, то здесь удачный союз может быть с Девой, причём в этом случае будет оптимальным вариантом общее дело. Вместе удастся добиться очень многого, это будет объединять и скрепит союз на долгие годы.
  • С Козерогом совершенно противоположные характеры, но это тот случай, когда противоположности притягиваются. При условии, что это будет настоящее чувство, всё может быть построено именно на любви. Но если она вдруг уйдёт, союзу больше не на чем будет держаться.
  • Привлекателен в данном случае и Рак. У обоих очень хорошо развита интуиция, гармоничные и высокоразвитые личности всегда придут к компромиссу и смогут найти выход из трудных ситуаций.
  • С женщиной, родившейся под знаком Льва, семьи не сложится, но возможен яркий короткий роман с незабываемым сексом. Других отношений не получится. Такая же ситуация ждёт и с Овном, и с Весами.
  • С Тельцом можно попытаться построить отношения, но здесь вопрос в том, хватит ли терпения у обоих переживать сложные времена и кризисы.
  • С Рыбами отношения построить можно, но не будет в отношениях той эмоциональной искры, которая так необходима Скорпиону-Быку. В итоге станет просто скучно и неинтересно вместе, из-за чего расставание произойдёт по обоюдному согласию.
  • Со Скорпионом будут постоянно возникать проблемы из-за соперничества и проявления эгоизма. Такой брак обречён на неудачу.
  • Со Стрельцом возможны лишь тёплые дружеские отношения, которые вряд ли перерастут во что-то другое.
  • С Близнецами, как и с Водолеем не возникнет взаимопонимания. На уступки друг другу не пойдут, а обиды, в конце концов, переполнят чашу терпения, недостатки будут видны больше, чем достоинства.

О взаимоотношениях людей, рожденных в год Быка, смотрите в следующем видео.

Скорпион Андрей характеристика. Андрей — значение имени

Имена: происхождение и формы

Андрей — (с греч.) мужественный, отважный.

Производные : Андрейка, Андря, Андрюха, Андрюша, Андрюня.

Справочник русских имен

Мужественный, отважный (с греч.).

Упрямый. Интеллектуальный, изобретательный, с неустойчивым характером. Им свойственно доминировать в обществе, часто теряя чувство меры при выборе средств.Как мужчины самоуверенны, а ведь… они только мечтают о покое.

Тайна имени oculus.ru

Андрей — мужественный (др.-греч.).
Имя с сильной энергетикой, обычное.
Зодиакальное имя : Рак.
Планета : Уран.
Цвет названия : фиолетовый.
Каменный талисман : аметист.
Благоприятное растение : пихта, анемон.
Имя покровителя : камышовый кот.
Счастливый день : Понедельник.
Счастливое время года : лето.
Основные черты : мужественность, обаяние.

Имена, святые покровители

Андрей Боголюбский , Великий Князь, 17 (4) июля 23 (10) декабря. Угодил Богу благочестием, попечением о бедных и больных, основал Боголюбский монастырь близ Владимира, убит своей свитой в 1174 году.
Андрей Вологодский , князь, 23 (10) сентября.
Андрей Эфесский , пресвитер, священномученик, 3 октября (память 21 сентября).
Андрей Константинопольский , Христа ради, юродивый, 15 (2) окт.
Андрей Критский , Архиепископ, 17 (4) июля.
Андрей Критский , преподобномученик 30 (17) октября.
Лампсакский Андрей , мученик, 31 (18) мая.
Андрей Месукевский , грузин, мученик 28 (15) апреля.
Оксиринфский Андрей (Египтянин) Рев. 15 (2) декабрь.
Андрей Первозванный , апостол двенадцати, брат апостола Петра, священномученик, 13 июля (память 30 июня).
Андрей Рублев , преподобный, иконописец, ученик преподобного Сергия Радонежского, 17 (4) июля.
Андрей Сиракузский , мученик, 6 октября (память 23 сентября).
Андрей Смоленский , Переславский, князь, 5 июня (23 мая), 9 ноября (27 октября).
Андрей Стратилат , Таврия, мученик, 1 сентября (19 августа) — военачальник и с ним 2593 воина мученически скончался за веру Христову в 302 году.
Андрей Тотемский , Христа ради, юродивый, 23 (10 ) Октябрь.
Андрей Фивайдский Монах, 25 (12) июня. 13 декабря (30 ноября). Галилеянин Андрей ловил рыбу на Тивериадском озере (Галилейском море) и был членом общины учеников Иоанна Крестителя, и был одним из первых призванных Иисусом Христом в число апостолов, поэтому он называется Первозванным. По преданию, он проповедовал христианство балканским и причерноморским народам, в частности скифам, и был распят по приказу римского магистрата в греческом городе Патры на кресте в виде буквы «Х» (т. н. св.Андреевский крест). На Руси этот герой-апостол пользовался особой любовью во все века. Так, в «Повести временных лет» говорится, что апостол Андрей из Корсуни (Херсонеса) достиг мест, где должны были стоять в будущем Киев и Новгород, благословляя эти места. В эпоху Киевской Руси Андрей Первозванный был покровителем русской государственности. В имперской России он стал прежде всего покровителем русского флота: Петр I учредил Андреевский флаг, а также орден — старейший из наших орденов.

НАРОДНЫЕ ПЕРСОНАЖИ, ТАМОЖЕННЫЕ

13 июля — Андрей-налив: «На Андрее зимы навалом дошли, а батько-овёс полувырос».
1 сентября — Андрей Стратилат, теплица. Начало бабьего лета. Ветер, дующий с юга в этот день, обещает хороший урожай овса: «День Стратилата созрел — овес созрел».
13 декабря прислушиваются к Андрею Первозванному воду: спокойная вода — добрая зима; шумно — приближаются морозы, бураны, метели.
Вечером девушки гадают о суженом.
Девушки молятся Андрею Первозванному о даровании хороших женихов.

ИМЯ И ХАРАКТЕР

Андрюша вертлявый, шумный и подвижный, не очень послушный старшим.

В подростковом возрасте любит что-то изобретать, ставить химические опыты, собирать конструктор, сам придумывать новые модели.

В школе учится хорошо, самостоятелен и горд, поражает одноклассников своей честностью, борется за справедливость, заботится о слабых.

Вне школы живет своей жизнью, не увлекается общественной работой. Хорошо играет в шахматы, разбирает шахматные задачи. Любит футбол, баскетбол. Он жалеет бездомных собак и кошек, кормит их.

Взрослый Андрей — мужественный и обаятельный человек, всем нравится, легко становится членом любого коллектива. Он может отстаивать интересы коллеги перед начальством, поддерживать веселую компанию, играть на гитаре, знать массу анекдотов. К работе относится очень добросовестно, никогда не жалуется.У него есть стремление к новым действиям, но он не будет рисковать.

Эндрю не так прост, как некоторые думают. Он философ, умеет поддержать беседу с умным человеком, обменяться мыслями. У Андрея потребность в самовыражении, проницательность, критический склад ума.

Андрей обладает литературным даром, владеет ораторским искусством. У него может быть творческая профессия — режиссер, актер, художник; может заниматься точными науками.

В отношениях с женщинами Андрей непостоянен. Он знает себе цену и считает, что они должны ее добиваться.

Андрей семейный, но жену выбирает долго, под стать себе: его избранница должна быть элегантной, умной, выдержанной. Андрей будет требовать от жены всего внимания, ревновать, но сам готов проявить к ней максимум внимания. Благоприятен его брак с одной из тех, кого зовут Елена, Елизавета, Ирина, Клавдия, Лариса, Людмила, Мария, Наталья.

отчество : Андреевич Андреевна.

ИМЯ В ИСТОРИИ И ИСКУССТВЕ

Величайшим художником Древней Руси был Андрей Рублев.Родился в 60-х годах XIV века, умер между 1427 и 1430 годами. Был монахом Троице-Сергиева монастыря — художник-монах в Средние века — явление обычное.

Современники чтили Рублева не только как искусного мастера: его называли «смиренным монахом, совершенным мужем в добродетели, превосходящим всех мудростью», иными словами, человеком чистых высоких помыслов и редкостного ума.

Мы мало знаем о его жизни и работе. Его первые известные работы относятся к 1405 году. Он работает с Феофаном Греком и Прохором из Городца в Благовещенском соборе Московского Кремля.А через три года вместе с Даниилом Черным расписал новыми фресками Успенский собор во Владимире. Оба ордена были очень ответственными: Благовещенский собор — великокняжеский дворцовый храм. Владимирский Успенский собор — один из самых почитаемых храмов Древней Руси, предмет неутомимых забот великих князей московских, малоизвестных мастеров к их выполнению привлечь не удалось.

Эти работы определяют характер творчества Андрея Рублева: нежные оттенки красок, торжественные, но легкие и стройные фигуры, спокойные просветленные лица.Даже святые традиционного состава Страшного Суда исполнены доброты и сострадания к бедному грешнику.

В состав кисти Рублева входят три великолепные иконы с поясными фигурами Христа, ангела и апостола Павла. Особенно хорош Христос, так называемый «Звенигородский Спас», который сейчас хранится в Третьяковской галерее. Достойное спокойное лицо, задушевный взгляд, направленный прямо на зрителя и выражающий живое и активное внимание к нему; мягкие контуры с уложенными по ним прозрачными тенями и изумительно найденные цветовые сочетания, невольно рождающие музыкальные ассоциации, — все это говорит о выдающемся таланте мастера.

Самая известная икона Андрея Рублева – «Троица». Три златовласых, златокрылых ангела сидят вокруг низенького столика, головы их поникли, в глазах застыла печаль, губы сомкнуты. Средний вопросительно указывает на чашу с головой жертвенного тельца. Полный скорбной торжественности жест ангела, сидящего слева, как бы подтверждает неизбежность жертвы и, как бы вторя ей, медленно опускает руку стоящего справа.

Здесь все подчинено мелодичному ритму линий, красоте силуэта. Цвета иконы легкие и прозрачные, дополняют друг друга, перекликаются друг с другом. Красочные переходы очень нежные, это подмечали современники, говорили, что Андрей «пишет как дым».

Содержание иконки стало универсальным. Размещение фигур по кругу, повторение контуров, направление взгляда и движение к одному центру — чаше на столе — вызывают представление о единстве мыслей и действий персонажей.Спокойные позы, плавный ритм линий, чистые цвета рождают ощущение покоя, тишины, гармонии. Это то, чего всегда не хватало на земле. И, может быть, многие современники Рублева, так же, как и мы теперь, любуясь его иконой, видят в ней воплощение своей заветной мечты.

Андрей Рублев написал «Троицу» в один из тех счастливых моментов вдохновения, которые бывают только у гениев.

Публикуется с любезного разрешения проекта OKULUS — астропсихология.

др.: 1941-03-07

советский актёр театра и кино, Народный артист РСФСР

Версия 2.Что означает имя Андрей

Основой мужского имени Андрей является корень греческого слова «авдрос» — муж, мужчина. Имя имеет множество разновидностей: Анри — от французов, Андриаш — от молдаван, Ондржей — от словаков.

Маленькие Андрюши хитры и мечтательны. Они могут долго и увлеченно собирать «Конструктор», а могут и кричать по квартире, изображая то самолет, то всадника. непослушный. Любят сладкое, поэтому портят зубы с детства.Мать слушает по настроению, с отцом пытаются спорить. Если есть брат, с ним дружат и любят, к младшей сестре ревнуют и ни в чем ей не уступают.

Андрей, подросток, ничем не выделяется, но позже окружающие вдруг заметят, что он окончил спортивную школу, а в жизни стал лучше своих сверстников. Девушки жалуются на непостоянство Андрея: он легко может признаться в любви одной, а на следующий день, не заметив ее, пройти мимо другой.Кажется, его ничто не смущает. Следующему другу Андрей искренне расскажет все о себе, как на исповеди, но не обольщайтесь этим — вы никогда не узнаете об Андрее всего.

Среди Андреевых режиссеры, актеры, певцы, композиторы, художники. Однако одаренность в области искусства больше связана с «зимними» Андреевыми.

«Осень» Андреас, как правило, расчетлив, пунктуален, не витает в облаках, выбирает профессию в области точных и естественных наук.Удачлив в делах.

Андрей всегда ценится начальником в своей службе. Старшие сотрудники относятся к нему снисходительно, а те, кто помоложе, всегда ждут от него сюрпризов. Никто не знает, что может прийти в голову Андрею в следующую минуту. Импульсивный и непредсказуемый, он может вызвать у жены настоящий восторг редким и дорогим подарком, а потом вдруг строптивиться и вывести ее из себя тем, что наотрез откажется от покупки давно нужной в хозяйстве копеечной вещицы.

В жены Андрей выбирает красивую, эмоциональную, внешне эффектную женщину, почти не интересующуюся своим характером и внутренним миром.Уговоры родственников и предостережения друзей не торопиться с браком отвергаются. У Андреев завышенная самооценка, они эгоистичны и артистичны, требуют к себе повышенного внимания. Они могут ревновать жену, если она много времени уделяет ребенку, и мало ему. Эндрюс бережлив, рационален в материальных тратах. Отношения со свекровью обычно сложные.

Независимо от расположения звезд при рождении Андрей с отчествами Александрович, Абрамович, Игоревич и Олегович сложны в общении, имеют сложный характер.

Брать Варвару, Зою, Клару, Нелли, Оксану, Ольгу, Софью, Юлю надо очень осторожно. Андрею лучше отдать предпочтение девочкам по имени Алевтина, Веста, Данута, Джульетта, Диана, Елена, Елизавета, Ирина, Клавдия, Лариса, Лия, Людмила, Мария, Наталья, Таисия.

Значение имени Андрей, которое уже несколько десятков лет находится на пике популярности, сочетает в себе множество положительных черт. Он наделяет своего владельца отвагой, отвагой и решительностью.

Андрей — русское имя с несколькими версиями происхождения (греческой, католической и православной).Среди христиан наиболее почитаемым обладателем имени был Андрей Первозванный, который был братом апостола Петра и первым учеником Христа. Закончил свою жизнь святым в городе Парте, где был распят на кресте в виде буквы «Х» (впоследствии этот символ получил название «Андреевский крест»). Апостол Андрей в православии считается покровителем многих стран (Румыния, Греция, Украина, Россия) и военно-морских сил Российской Федерации. Среди католиков он почитается в Сицилии, Бургундии и Шотландии.

Что означает имя для мальчика

Значение имени для мальчика важно учитывать еще при его выборе. Андрей – непоседливый и активный ребенок, любит играть и узнавать что-то интересное. В школе мальчик может даже стать отличником, если родители приложат к этому процессу определенные усилия.

У маленького Андрея много разных интересов, среди которых особое место занимают животные. Если в доме есть домашнее животное, он с удовольствием возьмет на себя всю заботу о нем.Если такого друга нет, то он непременно поведет его самостоятельно.

В подростковом возрасте Андрея ждут серьезные перемены в характере. Он становится более самостоятельным, не нуждается в родительской опеке. Но обладатель имени занимает в коллективе позицию лидера, ему доверяют, к его мнению прислушиваются. Андрей, в свою очередь, подбадривает окружающих своими знаками внимания, любит дарить подарки и не скуп в финансовом и эмоциональном плане.

По здоровью Андрея можно назвать одним из самых крепких.Единственная опасность – простудные заболевания, которые в детстве раз за разом постигают ребенка, и возможное чувство хандры.

Характер и судьба, связанные с именем

Имя Андрей, значение и судьба которого неразрывно связаны, наделено различными чертами характера.

Андрей непредсказуемый и импульсивный, мечтательный и быстро увлекающийся человек. Несмотря на то, что на публике он шутник и шутник, весельчак и оптимист, внутренний мир обладателя имени довольно сложен.Парень может быть очень злопамятным, он не прощает обмана и видит насквозь льстецов.

Андрей не имеет желания ввязываться в различные авантюры, так как любит стабильность и спокойствие. Парня считают ответственным и добросовестным, что ценится на рабочем месте. Для женщин главные черты его характера – отзывчивость, чувство юмора и обаяние.

Отличительной особенностью имени является то, что его обладатель, хоть и наделен способностью к самокритике, но часто завышает собственную самооценку.Он любит поток внимания к своей персоне и не терпит конкуренции. Если его затмевает успех, то Андрей может превратиться в тщеславного и высокомерного человека, от которого отворачиваются окружающие. Но быстро понимает, что был неправ, если на него указывают самые родные люди.

Одной из отрицательных черт характера является стремление казаться людям лучше, чем они есть на самом деле. И даже если Андрею на это укажут, он будет отстаивать свое мнение и позицию.

У парня могут быть разные отношения с девушками.Все зависит от его намерений, часто Андрею обещают «золотые горы» и любовь до гроба, причем сразу несколько страстей. С некоторыми женщинами он откровенен, может излить душу, рассказать обо всех своих проблемах. По крайней мере, так кажется спутнику, хотя узнать обо всех его секретах никому не дано.

Характер обладателя имени во многом зависит от того, когда родился мальчик.

Сезонность является одним из наиболее влияющих факторов:
  1. Зима. Зимний Андрей не терпит несправедливости и лжи.Обладает принципиальным характером, любит отстаивать свою точку зрения в любой ситуации. Отношения с девушками носят романтический характер, парень обаятельный и обходительный.
  2. Весна. Непоследовательность и легкомыслие – главные черты весеннего Андрея. Семейные дела и любовь всегда для него на втором плане. Главное – получить новые ощущения от жизни.
  3. Лето. Любитель жизни, обладатель прекрасного чувства юмора и легкого характера — все это относится к летнему Андрею.
  4. Осень. Наметить четкий план и неуклонно следовать ему по жизни – вот главное кредо осени Андрея. Сюрпризы и случайности не для него, все просчитано до мелочей. Пунктуальность, самодисциплина и способность мыслить аналитически помогают строить жизнь таким образом.

В целом судьба обладателя имени строится в зависимости от его характера и складывается положительно.

Когда Андрей празднует именины

Имена имени можно праздновать три раза в году:
  • 13 декабря;
  • 13 июля;
  • 1 сентября.

Совместимость отчества

Андрей — это имя, которое сочетается со многими отчествами.

К нему подходят следующие варианты:
  • Борисович;
  • Олегович;
  • Сергеевич;
  • Петрович;
  • Владимирович;
  • Андреевич;
  • Семенович;
  • Максимович;
  • Николаевич;
  • Богданович;
  • Матвеевич;
  • Степанович.

Бизнес и карьера

У Андрея есть творческие задатки, поэтому он может стать актером, режиссером, оратором, литературным деятелем или художником.При достаточном стремлении он способен овладеть точными науками, добившись невероятных карьерных высот.

В коллективе к Андрею все относятся с теплотой. Он является душой любой компании, при этом обладая такими качествами, как ответственность и высокая работоспособность. Если ему интересна сфера, в которой он работает, то Андрей также будет постоянно повышать свою квалификацию. Начальство это ценит, поэтому карьерный рост в любой сфере гарантирован.

Единственное, что может затруднить работу, — это боязнь риска.Поэтому в делах обладатель имени движется неторопливо, просчитывая каждый свой шаг. Иногда это мешает развитию дела, но в итоге дает положительные результаты.

Важно. Так как характер обладателя имени очень стойкий, ему не составит труда выбиться в лидеры и стать главой крупной корпорации.

Брак и семья, совместимость с женскими именами

Андрей всегда считает себя немного лучше других, поэтому его любовные отношения могут быть проблемными: он ищет себе спутницу, которая должна его добиться.Обладательница имени долго выбирает вторую половинку, сочетающую в себе ум, элегантность, красоту, мягкость характера и эмоциональную сдержанность.

Андрей требует от жены повышенного внимания и дает его взамен. Ревнив и требователен, поэтому при появлении в семье детей не простит охлаждения чувств со стороны жены и переключения ее внимания на малышей.

Стоит отметить, что Андрей не склонен к предательствам и сам их не прощает.Чтобы не ошибиться с выбором спутницы жизни, стоит знать о том, с какими женскими именами повышенная совместимость, а с какими не удастся построить прочный союз.

Хорошая совместимость с женщинами по имени:
  • Мария;
  • Наталья;
  • Людмила;
  • Элизабет;
  • Елена;
  • Лариса.
Менее удачная совместимость с носителями следующих форм имени:
  • Оксана;
  • София;
  • Юлия;
  • Зоя;
  • Татьяна;
  • Галина;
  • Валерия;
  • Лидия.

Из обладательницы имени выходит прекрасный отец, который может многое дать своим детям. Он с удовольствием учит с ребенком уроки, ходит на прогулки и принимает полноценное участие в его воспитании. Андрей никогда не забудет о подарке ребенку на день рождения и постарается осуществить все его мечты. Особую любовь он проявляет к своим дочерям, всячески балуя их и оберегая от всех невзгод.

Мужчина вряд ли будет помогать по дому, занимаясь «женскими» делами.Максимум, на что может рассчитывать супруг, — простой приготовленный ужин без излишеств. Зато все, что касается ремонта и прочей работы сильного пола, будет сделано без лишних напоминаний.

Андрею сложно складываются отношения со свекровью. Он не любит, когда в семью лезут с советами и моралью. Поэтому мать должна знать границы дозволенного, чтобы избежать серьезных конфликтов с мужем дочери.

Талисманы и обереги для мужчины по имени Андрей

На каждое имя свои амулеты и талисманы:
  1. Камень-талисман — аметист и янтарь.Аметист поможет защитить от сглаза и порчи, улучшит физическое и эмоциональное самочувствие. Янтарь способен привлечь удачу и счастье, дать веру и вдохновение для начала творческих процессов. Главное не обрамлять этот камень серебром, лучше всего выбрать медную оправу, которая не будет блокировать силу талисмана.
  2. Талисман-животное — тотемное животное имени камышовый кот, символизирующее богатство и силу, мудрость и могущество.
  3. Растение-талисман — наличие пихты или анемонов в жилище или рядом с ним обеспечит обладателю имени спокойную жизнь.Считается, что пихта помогает отказаться от вредных привычек и низменных желаний, что впоследствии станет хорошим залогом для поступления в рай.
  4. Амулет — Лучше всего Андрею носить с собой фигурки перечисленных талисманов из соответствующих материалов. Что касается цвета, то амулет должен быть коричневым или желтым, так как именно эта цветовая палитра приносит удачу обладательнице этого имени.

Андрей — это имя для смелых и настойчивых людей, поэтому среди них сложно найти неудачников и подкаблучников.Обычно это опора для родителей, жены и детей, надежный товарищ и отличный друг.

По Хигиру

Основой имени Андрей является корень греческого слова «андрос» — муж, мужчина. Имя имеет множество разновидностей: Анри — от французов, Андриаш — от молдаван, Ондржей — от словаков.

Маленькие Андрюши хитры и мечтательны. Они могут долго и увлеченно собирать «Конструктор», а могут и кричать по квартире, изображая то самолет, то всадника.непослушный. Любят сладкое, поэтому портят зубы с детства. Мать слушает по настроению, с отцом пытаются спорить. Если есть брат, с ним дружат и любят, к младшей сестре ревнуют и ни в чем ей не уступают. Андрей-подросток ничем не выделяется, но позже окружающие вдруг заметят, что он окончил спортивную школу, а в жизни стал лучше своих сверстников. Девушки жалуются на непостоянство Андрея: он легко может признаться в любви одной, а на следующий день, не заметив ее, пройти мимо другой.Кажется, его ничто не смущает. Андрей искренне расскажет о себе другому другу, как на исповеди, но не обольщайтесь этим — вы никогда не узнаете об Андрее всего.

Карьера по имени Андрей

Среди Андреевых режиссеры, актеры, певцы, композиторы, художники. Однако одаренность в области искусства больше относится к «зимнему» Андрееву, «Осенние» Андреевы, как правило, расчетливы, пунктуальны, не витают в облаках, выбирают профессию в области точных и естественных наук.Удачлив в делах. Андрей всегда ценится начальником за свою службу. Старшие сотрудники относятся к нему снисходительно, а те, кто помоложе, всегда ждут от него сюрпризов. Никто не знает, что может прийти в голову Андрею в следующую минуту. Импульсивный и непредсказуемый, он может вызвать у жены настоящий восторг редким и дорогим подарком, а потом вдруг строптивиться и вывести ее из себя тем, что наотрез откажется от покупки давно нужной в хозяйстве копеечной вещицы.

Любовь и брак имени Андрея

В жены Андрей выбирает красивую, эмоциональную, внешне эффектную женщину, почти не интересующуюся своим характером и внутренним миром.Уговоры родственников и предостережения друзей не торопиться с браком отвергаются. У Андреев завышенная самооценка, они эгоистичны и артистичны, требуют к себе повышенного внимания. Они могут ревновать жену, если она много времени уделяет своему ребенку, и мало ему. Они бережливы, рациональны в материальных тратах. Отношения со свекровью обычно сложные.

Им следует быть очень осторожными при женитьбе на Варваре, Зое, Кларе, Нелли, Оксане, Ольге, Софье, Юле.

Предпочтение лучше отдать девушкам с именами Алевтина, Веста, Данута, Джульетта, Диана, Елена, Елизавета, Ирина, Клавдия, Лариса, Лия, Людмила, Мария, Наталья, Таисия.

Отчество Андрей

Независимо от расположения звезд при рождении Андрей с отчествами Александрович, Абрамович, Игоревич и Олегович сложны в общении, имеют сложный характер.

По Менделеву

Яркое, веселое и очень мужественное имя, традиционно любимое в народе — и не только в России.Возможно, это связано с не столь распространенным сочетанием признаков «веселая» и «проворная». Но самые заметные признаки Андрея — «хороший», «громкий», «могучий» и «храбрый».

Персонаж имени Андрей

Люди именно с такими качествами становятся лидерами и ведут за собой других. Они преодолевают препятствия и находят выход там, где никто, кроме них, не смог бы это сделать. Конечно, временами они суровы; в имени Андрей отсутствуют значимые признаки «добрый» и «надежный»; возможно, средства, которые они выбирают для достижения своих целей, одобряются не всеми.Их активность достаточно высока и в сочетании с силой и мощью позволяет им добиться того, что недостижимо для других.

Довольно часто носители этого имени являются организаторами и лидерами. Они объединяют и ведут за собой, а иногда просто ловкие и успешные люди с мгновенной реакцией на изменение ситуации и умением использовать ее в своих интересах. Однако они не склонны причинять кому-либо вред и совершать поступки, кого-либо унижающие, — обычно это хорошие люди.Имя Андрей всегда было одним из самых популярных. Десять лет назад, например, по частоте употребления оно делило четвертое и пятое места с именем Дмитрий, лишь немного отставая от Александра, Алексея, Сергея и значительно опережая Владимира.

Основной цвет имени Андрей зеленый, даже голубовато-зеленый, с красной полосой по краю.

Сексуальный портрет имени (автор Хигир)

Очень чувствителен, любит лесть, комплименты. С женщинами он внимателен и заботлив, это нежный любовник.Он не разбрасывается цветистыми комплиментами перед своими партнершами, но никогда не упускает возможности показать им, насколько он ценит их прелести — дайте ему возможность говорить об этом вволю. Его любовные связи бесконечны. Для Андрея любовь чаще всего является формой самоутверждения в эротической сфере, признания своих сексуальных способностей, которые он может считать недостаточно развитыми.

Сексуальность имени Андрей

Бывает так, что сексуальная жизнь Андрея начинается достаточно поздно, что его первой женщиной становится жена, и он не до конца реализует свой сексуальный потенциал до свадьбы.Он быстро привыкает к переменам в окружающей среде, любит доставлять женщине радость даже в ущерб себе, просит ее рассказывать ей о своих желаниях. Во время первой встречи он может вести половую жизнь, но иногда ему просто хочется обнять свою женщину и заснуть рядом с ней. Для того чтобы проявлять высокие сексуальные качества, Андрей должен любить. В любви ему нужна терпеливая женщина, способная понять его трудности и разделить с ним радость, он ненавидит любое проявление грубости со стороны партнерши.Будучи по натуре страстным, он не слишком переживает любовные неудачи (в основном это касается «зимних» мужчин).

«Зима» Андрей жене не изменяет и сам никогда не потерпит не только ее измены, но даже легкого флирта с другим мужчиной. Он отличный любовник, полон энергии и жизнерадостности, своей элегантной внешностью может привлекать красивых женщин.

Д. и Н. Винтер

Значение и происхождение имени: «Мужественный» (греч.)

Энергия имени персонажа: Это имя обладает такой сильной энергетикой, что ее более чем достаточно для всех в мире Андреев.Андрей весельчак, Андрей балагур, чирлидер, душа компании, часто счастливчик, которому удача кажется в его собственных руках — все это привычные образы, сложившиеся в народном сознании. Иногда даже сам Андрей не может определить, так это или нет – ведь не все так просто и многое ему дается благодаря трудолюбию и терпению. Однако что-то, а энергия имени наделяет его терпением в избытке.

В то же время в имени присутствует удивительная трезвость и спокойствие, и поэтому часто за маской беспечности в Андрее живет довольно расчетливый наблюдатель.Он, конечно, не так прост и открыт, как кажется, хотя часто входит в свою любимую роль жизнерадостного человека настолько, что становится таким на самом деле. Даже когда ему грустно или тяжело, в общении с людьми Андрей легко находит необходимый заряд бодрости и оптимизма; друзья и знакомые, очарованные благоприятной энергетикой имени, сами начинают его забавлять.

Наверное, поэтому Андрей не склонен считать трудолюбие, благодаря которому он достиг своего положения, своего рода подвигом.Для него это естественно, пока рядом есть друзья и все получается. Но попробуйте унизить или оскорбить Андрея! Будьте уверены, перед вами будет стоять совсем другой человек. Энергия имени не располагает Андрея к терпению врагов; может и промолчит, но обиду вряд ли забудет.

Отрицательные черты имени: Тем не менее, у любой силы есть и отрицательная сторона. Часто Андрей ослеплен своими успехами и ему начинает казаться, что всего в жизни он добился благодаря собственным усилиям.В этом, конечно, есть доля правды, но если бы все в жизни зависело исключительно от личных усилий! Может случиться так, что череда неудач выбьет Андрея из седла и разочарование в собственных силах будет настолько велико, что он падет духом. В этом случае от жизнерадостного Андрея мало что останется, люди начнут его избегать, перестав оказывать поддержку. Тогда он долго не увидит удачи, а депрессия будет усиливаться день ото дня.

Чтобы избежать такого неприятного поворота, Андрею просто нужно повернуть силу своего персонажа против этой хандры.Сумев спокойно относиться к неудачам и возвращая своему лицу жизнерадостную улыбку, Андрей может быть уверен, что ответная улыбка Судьбы не заставит себя долго ждать и люди будут рады помочь ему в любом его деле! А пока так и будет, Андрей добьется успеха практически в любой сфере, кроме разве что бюро ритуальных услуг, где его жизнелюбие вряд ли будет уместно.

Секреты общения: С Андреем не только легко общаться, но и можно поспорить.Но мы не советуем вам вдаваться в личные споры, если, конечно, вы не хотите получить довольно сильного врага. Он, скорее всего, охотно откликнется на вашу просьбу о помощи, тем не менее советуем вам все же знать в этой мере.

След имени в истории:

Андрей Макаревич

Из чего состоит портрет человека? Из его прошлого, настоящего или перспективы? Из мировоззрения, работы или хобби? Или всего понемногу, как разноцветные кусочки мозаики? Но что, если таких кусочков в чьей-то жизни слишком много? Тогда ничего не остается, как, отсеяв второстепенное, остановиться на самом главном.А самое главное, без сомнения, то, что Андрей Макаревич — живая легенда русского рока, бессменный лидер группы «Машина времени», философ, певец, музыкант. Его философия не в газетных интервью, не в кулинарных откровениях, не в подводном плавании, изобразительном искусстве, бизнесе. Она в его песнях и в его образе жизни, который сочетает в себе все эти несовместимые составляющие и толкает его в новые сферы, на покорение новых вершин.

Пожалуй, одной из главных движущих сил Макаревича является его любопытство, поистине не знающее границ.Что еще могло заставить человека попытаться проникнуть в суть практически всех предметов и явлений, будь то законы Вселенной, законы моря, законы успеха или законы солянки? Что касается самого Макаревича, то значительную роль в своей жизни он отводит интуиции, в том числе и своим снам. «В детстве меня часто преследовал один и тот же сон: как будто я ехала на лодке по озеру с родителями, как вдруг упала за борт навзничь и тут же ушла под воду. Много лет спустя, находясь под водой с аквалангом и глядя вверх, я был поражен, как потом во сне увидел точную картину.»

При всех своих разносторонних интересах Андрей Макаревич с холодным любопытством относится к политике как к непонятному явлению: «Я могу понять, когда человек с детства мечтает стать пожарным или космонавтом. Но когда он станет политиком? Мне это ужасно интересно. Потому что в детстве все должны были быть нормальными людьми. »

Имя Андрей происходит от древнегреческого слова «андрос», что означает «мужчина», «мужественный». После принятия христианства имя стало распространяться на Руси, до этого оно было известно только в Византии.В те времена именем Андрея называли только отпрысков знатных родов, затем имя распространилось среди простого народа.

В советское время пик популярности пришелся на 70-е годы прошлого века, когда Андреем звали каждого четвертого новорожденного мальчика. Это имя так же популярно сегодня, как и несколько столетий назад.

На протяжении веков энергетика имени Андрея становилась только крепче. Множество выдающихся личностей, с интересной судьбой и талантами, носящих это победное имя, прямое тому доказательство.Среди них великий физик и теоретик Андрей Сахаров, поэт и публицист Андрей Вознесенский, режиссеры Андрей Кончаловский и Андрей Тарковский, великий русский художник Андрей Васнецов, спортсмен Андрей Аршавин и многие другие.

Именины и святые покровители

Впервые имя Андрей появилось в церковном календаре благодаря Андрею Первозванному — ученику Иисуса Христа. Он был первым, кого Иисус призвал в апостолы (поэтому он и назван Первозванным).

По преданию, Андрей Первозванный обратил в христианство многие народы, благословил земли, на которых впоследствии были основаны такие города, как Киев и Новгород. Апостол был схвачен язычниками и распят на кресте, имевшем форму буквы Х. Так появился всем известный Андреевский крест, изображение которого есть на государственных флагах некоторых стран, по приказу и медали.

В России этот святой всегда пользовался особой любовью и уважением — он считается покровителем российской государственности и флота.Император Петр Первый своим указом учредил Андреевский флаг и Андреевский орден.

День именин Андрей может отмечать раз в году, я выбираю дату максимально близкую к моему дню рождения: 26 и 27 января; 17 и 21 февраля; 7 марта; 28 апреля; 31 мая; 3, 5, 11, 15, 23, 25 и 26 июня; 3, 13, 17, 19, 22 и 25 июля; 5 и 17 августа; 1, 6, 19, 20, 23 и 28 сентября; 3, 5, 6, 7, 15, 23, 30 и 31 октября; 9 и 11 ноября; 8, 10, 11, 13, 15, 16 и 23 декабря.

Характеристика названия

Андрей наделен импульсивным и непредсказуемым характером, он очень увлекающийся человек и мечтатель.Невозможно угадать, что произойдет с ним в следующее мгновение. Его внутренний мир очень сложен, хотя по его поведению это совершенно незаметно. Он балагур и балагур, оптимист и весельчак, способный заразить своей энергией всех окружающих. Но не обманывайтесь, Андрей достаточно злопамятен, он все замечает и все помнит.

Андрей всегда стремится к спокойствию и стабильности, старается не лезть на рожон и не вступать в сомнительные авантюры.За добросовестность и ответственность его ценят коллеги по работе, а за хорошее чувство юмора и отзывчивость — женщины и друзья. Своим обаянием он может покорить любого.

Несмотря на то, что Андрей довольно самокритичный человек, его самооценка часто завышена. Он падок на лесть, любит, чтобы на него обращали внимание и выделяли, и совершенно не выносит конкуренции. Окрыленный успехом, мужчина может вдруг стать заносчивым, тщеславным и самоуверенным, что может оттолкнуть от него людей.

Андрей любит покрасоваться, представляя себя в лучшем свете, чем он есть на самом деле. Он не хочет слушать советов, всегда отстаивает свое мнение. Девушкам придется столкнуться с непостоянством Андрея, он может раздавать обещания любви и верности направо и налево. Другой подруге мужчина может рассказать о себе все, как на исповеди, но ей не стоит обольщаться – она никогда не узнает о нем всего. Все его стремления и желания сосредоточены на его собственной личности.

Характер Андрея во многом зависит от того, в какое время года он родился. Рожденный в зимние месяцы мужчина будет иметь принципиальный характер, не потерпит лжи и несправедливости, зато с девушками будет учтив и романтичен.

Осень Андрей будет строить свою жизнь по четко намеченному плану, в котором не будет места случайностям и неожиданностям. В этом ему помогут самодисциплина, пунктуальность и аналитический склад ума.

Летний Андрей будет наделен от природы прекрасным чувством юмора, легким характером и жизнелюбием.Этому парню будут рады в любой компании.

Весна Андрей будет отличаться легкомысленным отношением к жизни, легкомыслием и непостоянством. Он будет жаждать приключений и новых ощущений, но его семья будет его мало интересовать.

Детство

Маленький Андрюша — тихий и спокойный ребенок, очень ласковый с мамой, к которой нежно привязан. Он достаточно энергичен, но прекрасно умеет играть в тихие игры в одиночку. Он с удовольствием соберет конструктор или починит сломанную игрушку.

Андрюшу сложно заставить подчиняться и слушаться, так как он достаточно упрям ​​и непослушен. Он может долго спорить с родителями, настаивая на своем.

В школе Андрей учится хорошо, но и не отлично; среди сверстников он выделяется только аналитическим складом ума и склонностью к дизайну и программированию. Андрюша не дружит с девочками, предпочитает компанию мальчиков. Подросток часто увлекается спортом, любит играть в шахматы и шашки.

У мальчика обостренное чувство справедливости, из-за чего он иногда может конфликтовать с учителями.В жизни класса не участвует, всякой ответственности старается избежать.

Педагоги и родители должны помнить, что силовое воздействие на Андрея совершенно бесполезно, необходимо использовать аргументированное убеждение, учитывая его врожденное чувство справедливости.

Здоровье

С детства у Андрея может быть плохое зрение и предрасположенность к простудным заболеваниям. Во взрослом возрасте возможны проблемы с желудком и кишечником.

Особое внимание следует уделять душевному состоянию, так как стресс и депрессия могут стать причиной развития многих заболеваний.Важную роль в поддержании душевного комфорта могут сыграть близкие Андрея люди, способные вселить в него оптимизм и уверенность в себе.

Сексуальность

Сексуальная жизнь Андрея начинается не рано, но потом молодой человек наверстывает упущенное. Он нежный и чувственный любовник, пытающийся угодить женщине даже в ущерб себе.

Андрею нравятся высокие и красивые девушки, но ее характер и внутренний мир его мало интересуют. Главное для него – эффектная оболочка.Он нежен и внимателен к своей избраннице, но чаще всего им руководит не любовь, а желание произвести впечатление.

В сексе Андрей не терпит грубости и насилия, а также отсутствия женственности у партнерши. Мужчина очень падок на лесть и комплименты, поэтому если женщина хочет обратить на себя внимание, ей не стоит скупиться на приятные слова.

Совместимость в браке и семье

Андрей долго выбирает свою вторую половинку, обращая внимание, в первую очередь, на эффектную внешность.Он хочет гордиться красотой своей жены. Такое легкомысленное отношение к браку часто приводит к тому, что первый брак Андрея оказывается неудачным.

От своей спутницы требует повышенного внимания к себе, может даже ревновать к собственным детям. Измены он не потерпит, а сам запросто может закрутить роман на стороне (за исключением Андрея, родившегося зимой).

Все бытовые проблемы лягут на плечи жены, а вот полное финансовое обеспечение семьи Андрей возьмет на себя.Его избраннице стоит забыть о карьере и стать заботливой и сексуальной домохозяйкой. Ей также придется смириться с упрямством и некоторой скупостью мужа.

Удачный брак возможен с женщинами по имени Алевтина, Алиса, Алина, Диана, Елена, Елизавета, Ирина, Клавдия, Лариса, Людмила и Наталья. Лучше избегать отношений с Оксаной, Ольгой, Софией, Юлией, Верой, Анной и Яной.

Бизнес и карьера

Андрей добросовестно подходит к любому делу, кем бы он ни работал.Он обдуманно подходит к делу, не любит рисковать. Андрей – уникальная личность, одинаково подходящая как для творческих профессий, так и для инженерно-технической работы.

Он может стать актером, режиссером, писателем, художником и писателем, а может стать программистом, инженером, ученым, дизайнером или менеджером. Он отличный исполнитель, умеет учиться на своих ошибках, поэтому начальство его быстро оценит.

Самое главное для Андрея — достичь карьерных высот, которые повысят его авторитет в семье и среди друзей.При этом материальные блага будут стоять на первом месте.

Андрей может быть достаточно успешным в своем деле, которое будет вести честно и открыто. Партнеры могут быть уверены, что на слово Андрея всегда можно положиться.

Талисманы для Андрея

  • Планета-покровитель — Солнце.
  • Покровительствующие знаки зодиака — Рак и Стрелец. Гороскоп рекомендует называть Андреями мальчиков, родившихся под этими знаками.
  • Лето — хорошее время года.Хороший день недели — среда.
  • Счастливый цвет — желтый и коричневый.
  • Тотемное животное — камышовый кот. Это тотем сильных и богатых людей, так как не каждый может себе позволить содержать этого хищника. Лесной кот дарует силу, силу духа и мудрость.
  • Тотемное растение — анемон и пихта. Анемон – декоративный цветок с небольшим красным пятнышком, символизирующий одиночество, грусть и сострадание. Пихта – символ гордости, терпения и настойчивости. Это растение олицетворяет людей, сумевших отказаться от своих низменных желаний, и которым уготована дорога в рай.
  • Камень-талисман — янтарь и аметист. Янтарь – талисман для творческого человека, дарит вдохновение и веру. Амулет из янтаря привлечет к Андрею счастье и удачу. Но янтарь не может быть оправлен в серебро, для него лучше всего подходит медная оправа. Аметист – камень умиротворения, спокойствия и душевной благодати. Камень улучшает самочувствие и защищает от сглаза.

Гороскоп

Овен — это мужчина неуравновешенный, ранимый и обидчивый.Он непоседлив и упрям, что делает его жизнь яркой и насыщенной. У него часто меняется настроение, он может даже проявлять агрессию, но все это лишь следствие огромной неуверенности в себе. Импульсивность и максимализм, присущие Андрею-Овну, делают его неуживчивым человеком, с которым непросто найти общий язык. Но принципиальность по отношению к себе и другим, умение собраться и принять правильное решение в нестандартной ситуации вызывают уважение коллектива.Для жены Андрей-Овен будет надежным спутником жизни, но окончательную точку в их отношениях поставит измена жены. Он вспыльчив, но легок на подъем, умеет признавать свою вину, сострадать и прощать. Лучшей спутницей жизни для Андрея-Овна может стать женщина-Стрелец – им никогда не будет скучно вместе, их отношения со временем будут только крепнуть.

теленок — чувственный и сентиментальный мужчина, для которого главной движущей силой является любовь и стремление к материальному благополучию.Он умеет ждать, анализировать и сопоставлять факты, никогда никуда не торопится. Со стороны он может показаться медлительным и даже глупым, но на самом деле Андрей-Телец мыслит очень глубоко и объемно. Он всегда объективен, к его мнению и советам стоит прислушаться. Он никогда не лезет в склоки и не слушает сплетен, не любит командовать и никому не подчиняется. Мужчина старается создать вокруг себя гармонию, он не выносит суеты. Его любовь рождается медленно, мексиканские страсти не для него.Но если мужчина влюбляется, он способен разрушить любые стены и преграды. В любви Андрей-Телец большой собственник и ревнивец, но в его семье всегда будет материальный достаток, и он станет заботливым отцом для своих детей. Лучшей парой для Андрея-Тельца станет женщина-Весы – они будут прекрасно дополнять друг друга.

Близнецы — любознательный, общительный человек, ищущий беспроблемных путей в жизни. Он избегает любых трудностей и утомительной работы, часто не может завершить начатое дело.Андрей-Близнецы страдает болезненной чувствительностью, может даже заболеть от переживаний из-за пустяковой ссоры. Ему очень важно, что о нем думают окружающие, он очень болезненно переносит критику. Человек непоследователен в мыслях и поступках, не видит в обмане большого греха. И окружающие, и он сам страдают от его излишней эмоциональности. Он может обидеться по любому поводу, а также шумно порадоваться по пустякам. Его эгоцентризм заставляет человека «тянуть одеяло на себя» везде, где только можно.Позерство – его главный бич, мешающий ему развиваться и двигаться вперед. В то же время Андрей-Близнецы наделен незаурядным умом и интеллектом, он талантливая и разносторонняя личность. Хорошей парой для Андрея-Близнецов может стать женщина-Овен – это будет гармоничный союз, в котором роли будут распределены поровну.

Рак — сентиментальный и чувствительный Андрей, но не любит показывать это внешне. Он теряется в незнакомой обстановке, старается не выделяться из толпы.Мужчине очень нужна эмоциональная поддержка, в жизни он всегда ищет заботу и тепло, без которых просто не может существовать. Обладает феноменальной интуицией, но мало ей доверяет и часто делает глупости. Андрей-Рак легко поддается панике и отчаянию, ему трудно вступать в новые отношения, еще сложнее что-то кардинально изменить в жизни. Но, несмотря на это, он может принимать решения и целеустремленно двигаться к цели, особенно если чувствует за собой надежный тыл в виде любящих его людей.Набравшись уверенности, Андрей-Рак способен многого добиться в жизни. Он очень семейный, ради чего готов на все. Внешне Андрей-Рак выглядит уверенным и сильным мужчиной, которым располагают женщины. Он легко влюбляется, но и быстро остывает. Женщина-Скорпион сможет понять тонкую натуру своего избранника – сумеет сохранить отношения на чувственном и доверительном уровне.

лев — темпераментный, благородный и тщеславный мужчина, привыкший всегда и во всем быть лучшим.Он уверен, что весь мир должен вращаться вокруг него и никак иначе. Он обладает яркой харизмой, которая делает его заметной личностью в любом обществе. Андрей-Лев падок на лесть, но не выносит критики, поэтому старается окружить себя людьми, разделяющими его мнение. Прямолинейность мужчины порой граничит с грубостью, а неудачи и ошибки его никогда не смущают. Он прирожденный лидер, никогда не ограничивается краткосрочными целями, всегда стремится к глобальным перспективам. Честность и благородство заставляют Андрея-Льва бросаться в открытый поединок, а не строить интриги за его спиной.Он одинаково безумен в любви, дружбе и ненависти. В качестве спутницы жизни Андрей-Лев будет искать эффектную женщину, с которой ему не стыдно будет выйти в свет. Он будет настоящим главой семьи, нежным и заботливым, но вспыльчивым и ревнивым. Лучшей парой для него может стать женщина-Телец – она пробудит его чувственность и усмирит непомерные амбиции.

Дева — тонко чувствующий, интеллигентный человек с высокой работоспособностью и глубоким интеллектом. В коллективе он может быть незаметен, и только близкие люди могут знать, насколько он яркая и самобытная личность.Андрей-Дева — тонкий стратег, он всегда сможет найти лучший выход из любой ситуации. Он очень аккуратен и опрятен, любую работу выполняет безупречно. Он не потерпит в своем окружении ленивых и неряшливых людей, а вот излишняя подозрительность и придирчивость часто становятся причиной конфликтов. Андрей Дева очень независим, у него на все есть свое мнение, его практически невозможно переубедить. Он с трудом идет на компромиссы, а некоторая заносчивость и душевная холодность могут привести к тому, что Андрей-Дева коротал жизнь в одиночестве.Только настоящая любовь заставит его пойти на компромисс и простить возлюбленной ее недостатки. Нежность, верность и чувственную любовь Андрею-Деве может подарить женщина, рожденная под одним с ним знаком зодиака – этот союз будет просто идеальным.

Весы — это серьезная, прагматичная и детальная натура, слова которой никогда не расходятся с делом. Он темпераментный и горячий, но может быть нерешительным, если нужно принять важное решение. В человеке много противоречий, он постоянно находится в поиске гармонии, очень дорожит своей свободой и стремится к независимости.Он везде и во всем ищет то, что придаст его жизни стабильность. Андрей-Весы может производить впечатление слабовольного человека, так как часто не может отказать человеку в чем-то, а потом переживает по этому поводу. При возникновении трудностей мужчина предпочитает спокойно пережидать в сторонке, а не бросаться в открытый бой. Очень дорожит дружбой, всегда протянет руку помощи, причем совершенно бескорыстно. Но никакого унижения своего достоинства он не потерпит – в этом случае Андрей-Весы сможет проявить несвойственную ему жесткость и напор.В любви мужчина отличается необузданным темпераментом, ему нравится флиртовать и обожать женщин. Женщина-Водолей может стать идеальным вариантом для длительных отношений – эта пара может многого добиться в совместной жизни.

Скорпион — сентиментальный мечтатель, последний романтик и ловелас. У него прекрасно развита интуиция, его практически невозможно обмануть. Со стороны кажется, что он идет по краю пропасти, бездумно рискуя, но на самом деле Андрей-Скорпион никогда не переступает грань разума, у него все просчитано и под контролем.Он не агрессивен по своей природе, но смертельно опасен для своих врагов. Если Андрей-Скорпион поставил перед собой цель, он будет двигаться к ней на перерыв. Он отличный работник и руководитель, ответственный и справедливый. Мужчина имеет магическое влияние на людей, они ему верят и следуют за ним. Несмотря на сильный характер, Андрей-Скорпион очень нуждается в любви, но не каждая партнерша способна вынести капризность, упрямство, а порой и агрессию этого мужчины. Для брака ему лучше всего подходит женщина-Рыбы, так как она терпелива, умна и чувственна – то, что нужно этому неординарному мужчине.

Стрелец — жизнерадостный, оптимистичный мужчина с неиссякаемым обаянием. Он смотрит на жизнь философски, никогда не впадает в крайности и всегда держится достойно и спокойно. Андрей-Стрелец любит учить и учится сам, раздавая советы направо и налево. У него открытая и широкая душа, много друзей и знакомых, которым он готов помочь устно и материально. Он никогда не врет, не подстраивается и не играет, такого же отношения требует и от других. Он известный борец за правду и справедливость, прекрасный дипломат, способный направить переговоры в нужное русло.Он прямолинеен и напорист во всем — в работе, дружбе и любви. Мужчина долго ищет идеальную спутницу жизни, поэтому женится довольно поздно. В душе он романтический бродяга, совершенно не стремящийся к устроенной семейной жизни. Можно сказать, что он не создан для семьи, и редко какой женщине удается удержать его рядом с собой надолго. Женщина-Рак может это сделать, но только в том случае, если уставший от одиночества мужчина почувствует потребность в тихой уютной гавани.

Козерог — амбициозный, осторожный и практичный человек, медленно, но верно продвигающийся вперед.Он никогда не рискует напрасно, а точно рассчитывает ситуацию и собственные силы. Очень не любит хаотичных, импульсивных действий, всегда все тщательно планирует. Он прекрасный организатор и исполнитель, уверенно шагающий по карьерной лестнице. Как руководитель он внимателен к людям, но в то же время требователен и строг. На людей производит благоприятное впечатление, но под видом пышности, иногда может скрываться цинизм, высокомерие, недовольство всем и всеми.По натуре Андрей – Козерог-меланхолик, всегда готовый впасть в истерику и депрессию, если что-то пойдет не так. Он боится любви, потому что боится страданий и душевных терзаний. Умеет четко разделять любовь и секс, отдавая предпочтение последнему. В паре с женщиной-Водолеем может сложиться крепкая семья – их ждет блестящее будущее.

Водолей — непредсказуемая, свободолюбивая личность, с сильно развитой интуицией. Он постоянно меняется, примеряет различные маски, экспериментирует как в работе, так и в общении.Он мыслит абстрактно — он настоящий изобретатель, умеющий видеть нестандартно и творчески. Одни считают его занудой и большим педантом, а другие гением. Очень часто реальный мир кажется человеку серым и скучным, и тогда он погружается в свои мечты, в свой вымышленный мир. Тем не менее, Андрей-Водолей очень общителен, артистичен и всегда имеет вокруг себя много друзей и товарищей. Он не страдает карьеризмом и первым откликается на помощь в нужде, причем совершенно бескорыстно. Мужчина часто идеализирует свою избранницу, представляя ее в лучшем свете, чем она есть на самом деле, и закрывая глаза на ее недостатки.По этой причине он часто ошибается в выборе и несчастлив в личной жизни. Крепкую семью Андрей-Водолей может создать с женщиной-Львом – они будут уважать независимость друг друга, но им придется научиться идти на уступки.

Рыбка — нежный, мечтательный мужчина с хорошим воображением, которому никогда не бывает скучно в одиночестве. Это интересная личность, но у него есть одна особенность – он всегда стремится приукрасить действительность, поэтому часто становится объектом насмешек.Хорошее чувство юмора помогает Андрею-Рыбам выжить в этом циничном мире. Он, как никто, умеет слушать и сопереживать, но старается не привлекать к себе внимания в обществе. Мужчина не расчетлив, не честолюбив и не заносчив, поэтому ему трудно достичь карьерных высот. Но ему совсем не нужна помощь, так как он часто упивается своей жертвой, и никакая другая жизнь ему не нужна. Завоевать сердце Андрея-Рыбы очень сложно, еще сложнее его удержать, соответствовать тому образу, который он нарисовал в своих фантазиях.Старается избегать прямого влияния на себя, хотя очень нуждается в поддержке и понимании, а также пользуется успехом у женщин. Женщина-Козерог может стать идеальной спутницей жизни для этого неуверенного в себе мужчины – она не будет торопиться и нервничать по пустякам, являясь образцом спокойствия и уверенности.

Скорпион: Полное руководство | Popular Vedic Science

Основные черты

Скорпион известен как वृश्चिक (врищик) на санскрите, или «скорпион». Каждый знак зодиака характеризуется определенными основными чертами.Сюда входят Символ, Планетарный Правитель, Элемент, Природа и Пол. Общий состав знака Скорпиона приведен ниже:

Знак Скорпиона. Скорпионы интенсивны и скрытны. Они могут резко реагировать, если их спровоцировать.

Управляется Марсом.  Марс — планета войн, взрывов, внезапных событий и земли. Марсиане трудолюбивы и уверены в себе

Водный знак.  Люди с Луной в Скорпионе проницательны, артистичны и сентиментальны.

Фиксированный знак.  Люди, рожденные под этим знаком, уравновешены, предсказуемы и медленно меняются.

Женский знак.  Это делает человека восприимчивым, чувствительным и чутким.

Сильные стороны Скорпиона

Будучи марсианским знаком, Скорпионы — прирожденные бойцы. Внешне они собраны и спокойны, но внутри полны энергии и силы. В любой момент вы можете начать действовать. Вы трудолюбивы и обладаете большой внутренней силой.

Этот знак, символизируемый скорпионом, известен тем, что производит честных и прямолинейных людей. На вас не влияет мода или политика — вы высказываете свое мнение, не опасаясь реакции окружающих. У Скорпионов странный подход к ним. Вам очень комфортно просто быть собой. Вы избегаете притворства и редко угождаете требованиям окружающих.

Скорпионы обычно тихие и замкнутые. Они склонны заниматься своими делами. Это острые мыслители с художественным воображением.Они сильные и убедительные ораторы, и они без колебаний выскажутся, когда увидят несправедливость.

Сочетание огненного марса с водным знаком скорпиона рождает человека, способного к колоссальным перевоплощениям. Вы не боитесь бросить вызов статусу-кво, а ваши радикальные наклонности вдохновляют других.

Карьера Скорпиона

Скорпионы тактичны и точны. Вы хорошо управляете своими деньгами и можете преуспеть в ряде профессий, в том числе в сфере духовности и мистицизма.Однако вы можете испытывать желание часто путешествовать, что может затруднить долгосрочную работу.

Рекомендуемая профессия:  Скорпионы становятся отличными хирургами, профессионалами в бизнесе, морскими или военными офицерами, учеными, химиками, юристами, политическими советниками и администраторами.

Профессии, которых следует избегать:  Возможно, вам следует избегать ролей, требующих высокой степени харизмы или обаяния. Например, карьера на телевидении, в продажах или дипломатии не подходит Скорпиону.

Слабые стороны Скорпиона

Скорпионы известны своей честностью и прямолинейностью, но иногда они могут быть суровыми критиками. У них острый язык, и они могут непреднамеренно обидеть друзей или членов семьи своей резкой манерой речи. Иногда вы можете быть бестактным и нечувствительным к чувствам других. Если вы чувствуете, что кто-то заслуживает наказания, вы можете действовать жестоко по отношению к нему.

Сила, с которой вы преследуете свои цели, заставляет вас игнорировать или попирать других.Вам может быть трудно приспосабливать свои собственные желания в угоду другим. Это заставляет других воспринимать вас как черствого и жестокосердого. Дело не в том, что вы неспособны к состраданию — вы просто требуете от других тех же высоких стандартов, которых придерживаетесь сами.

Скорпионы не славятся своей щедростью. Они могут заработать репутацию скряг. Это может привести к развитию холодного взгляда на жизнь, что может негативно сказаться на физическом и психическом здоровье. По этой причине у Скорпионов может быть более короткая продолжительность жизни, чем у их сверстников.Однако этот риск можно компенсировать, развивая свой интерес к метафизическому через медитацию и молитву.

Возможности для роста

Вы можете уравновесить свои природные силы и компенсировать слабые стороны, приложив усилия в следующих областях:

  • Пожертвуйте на благотворительность . Отдаете ли вы свои деньги или свое время, благотворительные акции помогают смягчить сердце и вызвать чувство сострадания к тем, кому повезло меньше.
  • Сдержи свою речь .Обязательно хорошо подумайте, прежде чем говорить. Слова обладают огромной силой, и при неосторожном обращении они могут причинить вред.
  • Обучение игре на музыкальном инструменте . Музыка приносит свет в жизнь, даже в самые мрачные моменты. Развитие любви к музыке поможет вам сохранять позитивный настрой.

Скорпион Отношения

Скорпионы не преуспели в межличностных отношениях. Однако они могут установить тесные связи с другими людьми, которые восхищаются их искренним и интенсивным подходом к жизни.

Друзья

Скорпионы могут подружиться с теми, у кого схожие интеллектуальные или духовные интересы. Однако, если вы не будете осторожны, ваша тенденция высказывать свое мнение без ограничений может привести к тому, что вы скажете что-то обидное. Это может повредить или даже положить конец дружбе.

Семья

Ваши отношения с матерью могут быть натянутыми. Со временем вы можете отделиться от родителей. Вашим детям будет интересна духовность. Вы, вероятно, хорошо ладите с ними.

Романтика

Скорпионы страстные любовники. Они могут сформировать тесную связь со своей второй половинкой. Тем не менее, есть риск упасть «по уши» для человека, не проверив, действительно ли вы двое совместимы в долгосрочной перспективе. Вас могут привлекать мужчины или женщины, или вы можете быть недоступны.

Совместимость

В ведической астрологии совместимость в отношениях является комплексной наукой, учитывающей множество различных факторов.Всегда полезно проконсультироваться с опытным астрологом, который может тщательно изучить ваши индивидуальные карты и карты вашего партнера.

Тем не менее, существуют общие закономерности совместимости знаков. Эти знаки обычно хороший матч для Scorpio:

Пол на первом взгляде

Scorpio Man
  • пациента
  • определяется
  • наружно спокойно, но агрессивный в течение
  • гг.

  • Гордый
  • Трудно понять
  • Хорошая борьба
Scorpio Woman
  • 3
  • Ambitious
  • преданной жены
  • Выделенная жена
  • Высокосоглавивная
  • Скрытый
  • мстительный
  • Saturn’s Mill

    Каждая планета управляет различными областями жизни .Сатурн — самая медлительная из планет, и его влияние часто сопровождается тяжелыми уроками.

    Когда Сатурн проходит через лунный знак натива, а также знак до и после него, это известно как  саде сати , или «Помол Сатурна». В этот период человек испытывает тяжелые кармические реакции. Однако при правильном отношении это может стать периодом огромного личного роста.

    для Скорпионов, периоды Sade Sati следующие:

    • 25 ноября 1952 г. — 1 февраля 1961 г.
    • г. 5 октября 1982 г. — 20 марта 1990 г.
    • 14 ноября 2011 г. 23 января 202002223
    • 27 января
      • 27 января, 2041 г. — 6 марта, 2049
      • ноября 4, 2070 — 14 января 9079

    Знаменитые Scorpios

    Политики

    Томас Джефферсон
    Gerald Ford
    NARENDRA MODI
    BEN BRADSHAW
    Mitt Romney
    Jesse Ventura
    Pete Buttigieg

    5 Актриса
    6

    Джима Parsons
    Джим Caviezel
    Danny Devito
    Hilary Danty
    Ashley Greene
    Breckin Meyer
    Tim Curry
    Paul Rudd
    Николь Кидман
    Кевин Костнер
    Джейсон Бейтман
    Джулия Луи-Дрейфус
    Джейсон Шварцман

    Музыканты

    Людвиг Ван Бетховен
    John Mayer
    Tommy Lee
    Jesse Sykes
    Carole King
    Dave Groll
    Yoko Ono
    Joan Suberland

    Joan 0

    Martin Luther
    RAM DASK
    Kahlil Gibran

    Writers / директоры

    Герман Мелвилл
    Чарльз Диккенс
    Льюис Кэрролл
    Эми Тан
    Пауло Коэльо
    Рассел Бэнкс
    Хантер С.Томпсон
    Ник Хорнби
    Dan Brown

    Философы / Ученые

    Альберт Эйнштейн
    Галилео Галилей
    Виктор Франкл

    Предприниматели

    Kate Spade
    Уоррен Баффет
    Опра Уинфри
    Michael Dell
    Андрей Мельниченко
    Омидьяр
    Дженсен Хуан

    Спортсмены

    Фрэн Таркентон
    Майк Тайсон
    Майкл Джордан

     

    Черты характера мужчины-Скорпиона, совместимость в любви и советы по свиданиям

    Астрология может помочь нам лучше понять себя и людей, которых мы любим/встречаем/в которых безнадежно влюблены, независимо от их пола.Чтобы узнать больше о совместимости со Скорпионом, ознакомьтесь с нашим руководством по знакомству с женщиной-Скорпионом и нашим гендерно-нейтральным руководством по знакомству со Скорпионом.


    Есть всего несколько основ, которые необходимо изучить, когда вы впервые начинаете встречаться с кем-то. Откуда он? Чем он зарабатывает на жизнь? О, и определенно , , когда у него день рождения? Это нужно не только для того, чтобы помнить, когда отправлять текст «с днем ​​рождения :)»! Знание знака зодиака потенциального хулигана действительно может помочь понять его поведение.Астрология помогает нам разрушить личностные черты, любимые мозоли и, да, даже модели свиданий. Это может быть весело, и информативны, чтобы посмотреть его знак и посмотреть, как ваш работает с его.

    Если вы встречаетесь, ведете инста-расследование (привет, виноваты) или просто фантазируете о мужчине-Скорпионе, мы здесь, чтобы помочь вам сориентироваться в одном из самых загадочных знаков. Эти сложные существа интенсивны, глубоки и сексуальны, но они могут быть настолько скрытными, что иногда их трудно понять.

    Этот контент импортирован из {embed-name}.Вы можете найти тот же контент в другом формате или найти дополнительную информацию на их веб-сайте.

    К счастью, астрология позволяет нам расшифровывать черты характера, любимые мозоли и многое другое. И поверьте мне, когда я говорю, что в мужчине-Скорпионе гораздо больше, чем вы изначально предполагали. На самом деле, они могут быть самыми осторожными знаками зодиака. Эти маленькие скорпионы ГЛУБОКИЕ.

    Так что, если ваш парень родился между 23 октября и 21 ноября , вас ждет угощение.Скорпионы делают жизнь (и секс) невероятной, но, как и для любого знака, есть некоторые вещи, на которые вы, возможно, захотите обратить внимание.

    Basics Scorpio

    день рождения:

    : Октябрь 23 по 21 ноября

    Модальность: Феринг

    Элемент: Вода

    Ruling Planet: Марс (традиционный) и Плутон (современный)

    Представлено: Скорпион

    Ключевые слова: Интенсивный, страстный, эмоциональный, скрытный, сексуальный, чувственный, глубокий, мстительный, осторожный, верный, страшный

    Гимн любви: «Без меня», Холзи

    Знаменитые мужчины-Скорпионы: Фрэнк Оушен, Марк Руффало, Джимми Киммел, Майкл Страхан, Адам Драйвер, Леонардо ДиКаприо, Дрейк, Райан Рейнольдс, Пенн Бэджли, Шон Комбс, Райан Гослинг, Оделл Бекхэм мл., Френч Монтана, Пенн Баджли

    Лучшая пара для мужчины-Скорпиона

    Абсолютно лучшая пара для Скорпиона — его товарищ по водному знаку Рак. Существует естественная совместимость между знаками одной и той же стихии, и оба знака огромные по доверию и близости. Точно так же Скорпион и Рыбы невероятно ладят. Оба являются глубокими мыслителями с мощной интуицией — они как будто могут читать мысли друг друга.

    Девы также отлично подходят Скорпиону.Ни один другой знак так не предан своему возлюбленному, как Дева, и когда Скорпион осознает, насколько предана его возлюбленная-Дева, между ними возникает очень тесная связь. Телец — зодиакальная противоположность Скорпиона — сосредоточен на удовольствии, которое Скорпион будет любить, и Бык также может научить Скорпиона быть немного более практичным.

    Иногда Близнецы могут также привлечь внимание Скорпиона — помимо того, что это два самых ненавидимых знака зодиака (ненавистники просто завидуют!), у них не так много общего, но они настолько разные, что они очарованы друг другом.

    Худшие пары для мужчины-Скорпиона

    Скорпионам иногда трудно найти общий язык с Львом. Скорпионы, как правило, более закрытые и скрытные, в то время как Лев настолько общителен — Льву легко заподозрить Скорпиона, а Скорпиону раздражает вся энергия Льва. По другой причине Скорпион и Водолей могут столкнуться лбами. Интеллектуальный Водолей — это весь ум, а Скорпион — это все чувства. Водолей может подумать, что Скорпион воспринимает вещи слишком лично и чрезмерно драматичен, в то время как Скорпион может считать Водолея холодным или бесчувственным.

    Тем не менее, наличие несовместимых знаков Солнца не означает, что ваши отношения обречены — это просто означает, что вам, возможно, придется немного поработать, чтобы по-настоящему ~заполучить~ друг друга. И в любом случае совместимость — это гораздо больше, чем ваш солнечный знак, поэтому, если ваши лунные знаки или другая часть вашей карты рождения хорошо сочетаются, вы все равно можете быть астрологически благословленной парой.

    Но даже если ваша карта рождения полностью соответствует Водолею, если вы приложите усилия, чтобы понять своего Скорпиона и наоборот, у вас тоже могут быть прекрасные отношения.И TBH, ~астрологическое напряжение~ также может привести к ~сексуальному напряжению~, так что есть что сказать о «несовместимости»!

    Секс со Скорпионом

    Секс со Скорпионом меняет жизнь. Эти скорпионы очень серьезно относятся к сексу — это опыт всего тела, всего ума, полного духа. Они, вероятно, предложат новые извращения и секс-игрушки для изучения, и они могут быть увлечены БДСМ или другими видами силовой игры. Чем бы они ни занимались, они не торопятся делать это — убедитесь, что вы выделили весь вечер для своего любовника-Скорпиона.

    Скорпионы также любят «секреты», поэтому они могут захотеть поиграть с управляемой приложением секс-игрушкой на публике (осторожно!!!). Им также понравится, если вы отправите им фотографию нижнего белья, которое вы носите (или , а не , которое носите…) под одеждой до того, как вы на самом деле встретитесь. Кроме того, оральный секс и секс-игрушки — одни из их любимых занятий.

    Кстати: у Скорпионов острое обоняние, поэтому, по крайней мере, обязательно примите душ, прежде чем увидеть их. И если вы пытаетесь произвести на них впечатление, используйте уникальные духи, одеколон или эфирное масло.Скорпионы обожают ~фирменный аромат~.

    Все о Скорпионе

    Скорпион — это парадокс. Его знак классифицируется как фиксированный знак, что означает, что он верен, предан и застрял на своем пути, но он также является водным знаком, что означает, что он эмоционально подвижен и полон страсти. Он управляется Плутоном, планетой трансформации и перемен, и Марсом, огненной планетой действия и энергии, в результате чего появляется загадочная фигура, которая представляет собой скрытый вулкан силы прямо под поверхностью. Его знак — один из самых интимных, и он парень типа «все или ничего» , поэтому, если он подведет свои стены, вы можете быть уверены, что он полностью очарован вами!

    С ним не ходишь на свидания — это приключения, которые быстро становятся яркими воспоминаниями.

    У его знака всегда есть тонна происходящего под поверхностью, независимо от того, насколько холодным как камень он кажется снаружи. Ни одна тема не является слишком табуированной для него — он обладает безумной эмоциональной и психологической глубиной и невероятно хитер. Знакомство со Скорпионом само по себе является опытом, но он делает еще один шаг вперед, усиливая все, что вы делаете вместе. Это никогда не просто поцелуй или объятие с ним — это объятие. С ним не ходишь на свидания — это приключения, которые быстро становятся яркими воспоминаниями.

    Футболка «Самый Скорпион-Скорпион»

    Он также очень предан делу. Из-за того, что он боится, что другие осудят дикие мысли, которые всегда крутятся в его голове, он неуверен в себе и с трудом подпускает к себе людей.После первых двух свиданий он подвергнет вас нескольким «испытаниям» и прощупает вас психологически, знаете ли вы об этом или нет! Однако, как только вы вошли, вы внутри. Он связывается с кем-то тогда и только тогда, когда он абсолютно уверен, что знает вас настоящую , и верит, что вы примете его таким, какой он есть на самом деле. Управляемый Марсом, названным в честь бога войны, он защитит своих близких всем, что у него есть, если потребуется. Редко можно найти кого-то столь же преданного, свирепого, страстного и верного, как влюбленный Скорпион!

    Он очень снисходительный знак, когда дело доходит до еды, питья и секса — вообще любых удовольствий.Но физическая близость ваших отношений ничто по сравнению с эмоциональной запутанностью, которая возникает между Скорпионом и его возлюбленной. Он хочет, чтобы ваши отношения были достаточно крепкими, чтобы он стал частью вас обоих. Даже если в конце концов ничего не получится, ты никогда не забудешь своего бывшего Скорпиона! Он любит всем сердцем, и ваши отношения обещают изменить жизнь — в конце концов, он — знак трансформации.

    Когда вы сражаетесь, он может защитить себя так же, как настоящий скорпион.

    Однако вся его тьма, тоска и задумчивость со временем могут надоесть! Даже если вы всегда были на одном уровне, и вы все равно поймаете его на попытке психоанализа ваших слов и действий на DL . Все вопросы и беспокойства с его стороны только запутывают и создают настоящую проблему, если это продолжается слишком долго! И когда вы сражаетесь, он может защитить себя так же, как настоящий скорпион, хотя, к счастью, до этого редко доходит.В конце концов, он фиксированный знак и очень медленно начинает действовать. Он лоялен и предан вам больше всего на свете, и он не был бы с вами, если бы не был уверен, что вы оба на 100 процентов в этом.

    Слово «плутократ» относится к тому, кто очень силен и очень богат. Находясь под управлением Плутона, мужчины-Скорпионы могут легко воплотить это мышление. Его ревность и потребность в контроле мешают. К счастью, Скорпионы прекрасно знают границы, поэтому, если вы установите здоровые границы, он будет их уважать. Проблемы с властью и контролем — это проблемы, с которыми сталкиваются все Скорпионы, но если вы будете соблюдать свои правила, он останется в узде.

    Этот контент импортирован из {embed-name}. Вы можете найти тот же контент в другом формате или найти дополнительную информацию на их веб-сайте.

    Но чтобы по-настоящему сблизиться с ним, вам нужно открыться ему. Он может учуять поверхностность за милю, поэтому, если вы не будете держать это в секрете с ним, он не будет долго вами интересоваться.Он заинтересован только в том, чтобы встречаться с тем, кто искренне хочет узнать его поближе. У него есть слои за слоями за слоями, но когда он доверяет вам достаточно, чтобы раскрыться, и вы достигаете сути того, кем он является на самом деле, это определенно того стоит. Несмотря на всю напряженность и эмоциональную драму, из-за которых Скорпионы имеют плохую репутацию, страсть и любовь, которые у них есть, трудно превзойти. Он сформирует с вами отношения, которые ни один из вас никогда не забудет!

    Подпишитесь на Джейка в Instagram.

    Джейк Регистрация
    Джейк Регистр (более известный под своей учетной записью в Instagram, @jakesastrology) — Весы и автор еженедельного журнала Cosmopolitan Sexoscopes.Эрика В. Смит
    Старший редактор по астрологии
    Как старший редактор журнала Cosmopolitan по астрологии, Эрика работает с членами Совета Cosmo(s), чтобы помочь вам расшифровать вашу карту рождения и подготовиться к каждому ретроградному Меркурию.

    Этот контент создается и поддерживается третьей стороной и импортируется на эту страницу, чтобы помочь пользователям указать свои адреса электронной почты. Вы можете найти дополнительную информацию об этом и подобном контенте на сайте piano.io.

    знаков плюсы и минусы.Здоровье женщины-Скорпиона

    Их называют фатальными. Они могут иметь совершенно обычную внешность, но, несмотря на это, все взгляды мужчин устремлены только в их сторону. Благодаря своему внутреннему магнетизму женщины этого созвездия добиваются поставленных целей и легко манипулируют окружающими людьми. Что еще скрывается за их загадочной и неприступной личностью?

    Какая она на самом деле?

    Женщина-Скорпион — загадочная личность, которая всегда оставляет за собой шлейф тайны и недосказанности.С юных лет она стремится к самостоятельности и самостоятельности. Еще в детстве она требует, чтобы к ее мнению прислушивались и считались. Характер у нее достаточно сложный. Сверстники иногда не понимают и не принимают его. Однако властный характер лидера все же позволяет ей заводить друзей и становиться среди них авторитетом.

    Взрослая женщина этого созвездия, как правило, быстро находит свое место в жизни. Она всегда знает, чего хочет добиться и кем хочет стать.Это целеустремленный и решительный человек. Ее характер энергичный, уверенный в себе, страстный и напористый.

    По натуре это злопамятный и злопамятный человек. Она никогда не позволит себя обидеть. Часто не просит помощи и мужской защиты, так как привыкла решать все свои проблемы самостоятельно. Если кто-то встанет у нее на пути, она не проявит ни жалости, ни сострадания. При этом представительница этого знака зодиака никогда не остается в долгу перед теми, кто когда-то помог ей или с пониманием отнесся к ее проблемам.

    Еще одной характерной чертой женщины-Скорпиона является стремление к риску и приключениям. Она легко может бросить все ради новых эмоций и впечатлений. Она любит путешествовать, довольно безрассудна и легко поддается соблазнам.

    На первый взгляд, женщина-Скорпион — железная леди. У нее мужской склад ума, что делает ее серьезным конкурентом в команде. Однако за этой маской сильной и уверенной в себе женщины скрывается ранимая и нежная натура, требующая любви, заботы и понимания.

    Разные сферы жизни

    Характер женщины-Скорпиона влияет на все сферы ее жизни. Она стремится к самовыражению, поэтому ее карьера и любовные связи часто зависят от ее настроения и желаний. Отличительной чертой женщины этого знака зодиака является то, что она отдается всему, что делает. Следуя своему порыву сердца и желаниям, она часто добивается успеха как в личной жизни, так и в карьере.

    Любовь и отношения

    Личная жизнь представителя этого знака бурная и яркая.У нее много поклонников и тайных поклонников. Однако она не торопится с выбором избранника и проверяет на прочность каждого претендента на ее сердце. Она избирательна, никогда не станет общаться с тем, кто не соответствует ее требованиям и запросам. Ищу мужчину под стать, того же социального уровня или выше. В вопросах любви он часто руководствуется интуицией.

    В отношениях она часто становится лидером, а не мужчиной. … Если у ее избранника сильный характер, то она постоянно борется с ним за лидерство в паре.Иногда стремление быть независимым и властным приводит к серьезным ссорам.

    Несмотря на свой непростой характер, женщина-Скорпион полностью отдается отношениям. Если любит, то делает это страстно и по-настоящему. … Если она ненавидит, то использует все средства, чтобы навредить или отомстить человеку, который ее обидел.

    Она очень ревнива. Не потерпит предательства и даже намеков на флирт с другими женщинами. Если она чувствует, что обманывает, то делает все, чтобы добиться правды.не прощает. Если партнер ее потерял, то вряд ли он сможет вымолить прощение и вернуть ее обратно.

    Карьера

    Женщина-Скорпион уверенная в себе карьеристка. Ради достижения профессионального роста она способна идти выше головы. Мужчины, окружающие ее на работе, для нее не соперники. Обладая мужским складом ума, она легко просчитывает каждый ход и действия своих конкурентов.

    Ей удается все, за что она берется с интересом и рвением. Быстро загорается энтузиазмом, но не угасает, когда на пути возникают трудности … Наоборот, борьба с препятствиями и решение сложных задач придают ей сил и азарта. Круг профессий, интересующих женщину-Скорпиона, широк: она может реализоваться практически в любом деле – от творчества до науки.

    Здоровье

    Природа наградила женщину этого знака зодиака крепким здоровьем и выносливостью. Она редко болеет. Не любит ходить к врачам и следовать всем их предписаниям.Если она и болеет, то внешне этого не показывает — она ​​тоже остается бодрой и энергичной. После перенесенных тяжелых заболеваний он очень быстро выздоравливает.

    Негативным аспектом в гороскопе здоровья женщины-Скорпиона является ее склонность к саморазрушению. Если она впадает в депрессию, теряет смысл жизни и не видит выхода из ситуации, то перестает следить за собой может пристраститься к алкоголю и наркотикам.

    Слабые стороны женщины-Скорпиона:

    • мочевыделительная система
    • половые органы
    • сердце и сосуды
    • спина
    • прямая кишка
    • 22 22

    Типичные болезни: гепатит, желчнокаменная болезнь, болезни глаз и болезни репродуктивной системы.

    Для сохранения здоровья и молодости ей рекомендуется чаще отдыхать и бывать на свежем воздухе. Женщина этого созвездия часто не замечает сигналов, которые посылает ее тело. Она должна слушать свое тело. Также важно соблюдать баланс во всем. Это касается всего, чем она занимается — работы, плотских утех, еды.

    Одной из основных причин ее эмоционального выгорания и возникновения заболеваний являются частые стрессовые ситуации. Женщина-Скорпион может долго копить обиды, страхи, негативные эмоции.Ей нужно чаще выпускать пар. Этому будут способствовать постоянные физические нагрузки, занятия спортом и контрастный душ.

    Как его победить, полюбить себя и удержать?

    Путь к сердцу этой женщины тернист и труден. Поклонники часто ломают голову и не понимают, чего именно она хочет. Ее довольно сложно удивить, и за тех, кому это удается, она готова отдать свое сердце. Как ни странно, очаровать этого человека можно не только с помощью щедрых подарков и романтических свиданий, но и проявляя свое равнодушие.

    Женщина-Скорпион — самая загадочная представительница зодиакального числа … И если она встретит загадочного незнакомца, то непременно захочет разгадать его тайну и завоевать его сердце.

    Удержать ее непросто — она ​​импульсивна и зависит от настроения. Она не прощает измены и предательства. Никогда не вернется к тем, кто когда-то ее обманул … Окружая ее вниманием, заботой, даря положительные эмоции, мужчина может сохранить с ней теплые отношения на долгое время.

    Откуда ты знаешь, что она влюблена?

    Если женщина-Скорпион влюбляется, то она этого не скрывает. Ее чувства настолько сильны, что она может первой признаться в любви. Она не боится отказа, который может задеть ее самолюбие.

    Иногда представительница этого знака закрыта от мира и не признается, что любит, даже самой себе … В этом случае по ее поведению сложно определить, что она чувствует. Если она уверена в чувствах своего избранника и видит его серьезные намерения, то отдается своим чувствам целиком и полностью.

    Какие мужчины нравятся женщине-Скорпиону?

    Ей нужен харизматичный, интересный и активный мужчина. Она никогда не выберет себе в спутники жизни безвольного нытика или пессимиста. … В мужчинах она прежде всего ценит оригинальность. Для того, чтобы ее покорить, необязательно иметь привлекательную внешность. Красота для нее не самое главное.

    Для нее важен социальный статус избранника. Если она уже добилась каких-то высот в карьере, то вряд ли обратит внимание на бедного артиста.Ей подходят сильные и уверенные в себе личности. В отношениях она отдает все свои чувства и страсть, и требует этого от своего спутника.

    Женщину-Скорпиона также привлекают мужчины, которые должны достичь … Не забывайте, что у нее мужской склад ума, а значит, у нее есть задатки охотницы и завоевателя.

    Кто ей подходит по гороскопу?

    Сильный характер женщины-Скорпиона часто отпугивает мужчин.Ее стремление быть независимой и во всем первой иногда мешает найти спутника жизни. Она не умеет прогибаться и хочет, чтобы ее мужчина принимал ее такой, какая она есть.

    С какими знаками зодиака женщина Скорпион найдет свое счастье?

    Гороскоп совместимости: значение знака зодиака скорпион девушка — самое полное описание, только проверенные теории, основанные на астрологических наблюдениях нескольких тысячелетий.


    Ваша девушка Скорпион? Характеристика представителя этого знака зодиака такова: они обладают загадочной красотой, уверенностью в себе, привлекательностью, загадочностью и, что самое интересное, обладают мужским складом ума.

    Девушка Скорпион — ее характеристика

    Попробуем затронуть все глубины души девушек — Скорпионов. Скорпионы – девушки переполнены жизненной энергией, поэтому у них всегда есть потребность найти своей энергии применение.

    Поэтому они часто отправляются в незапланированные путешествия, способны с головой броситься в авантюры и заниматься довольно сложными проектами.

    В их судьбе немало испытаний, но благодаря их высокому духовному потенциалу сломить их очень сложно.Если все же ее настигло поражение, она никогда не сдастся и снова попытается добиться намеченной цели.

    Кокетливость, соблазнительность и крайняя привлекательность принесли ей звание роковой женщины. Поэтому мужчины часто становятся ее рабами, можно сказать, что такая привязанность запросто может его погубить. Мужчины готовы пожертвовать многим, чтобы угодить девушке – Скорпиону.

    Персонаж девушки со знаком Скорпион

    Представители этого знака очень гордые, они не приемлют сплетен за спиной.Они никогда не позволят себя обидеть или оскорбить, но если кому-то удалось это сделать, то их ждет самая жестокая месть. Но несмотря на все это, Скорпионы умеют прощать. Они очень высоко ценят чужую заботу, отдают взамен собственную доброту и преданность.

    девушки-Скорпионы могут быть очень верными друзьями, хранить чужие секреты, поддерживать в трудную минуту и ​​демонстрировать порядочность в отношениях. Но они часто скрытны, до такой степени, что даже близкие не знают об их проблемах, мыслях, чувствах и даже обо всей стороне их жизни.

    Девушка-Скорпион в отношениях

    Ни для кого не секрет, что все Скорпионы любят деньги и роскошь. Поэтому девушка, рожденная под этим знаком, может безрассудно тратить деньги, и в то же время отчаянно копить их. Вот такая загадочная и непредсказуемая девушка знака зодиака Скорпион.

    В качестве второй половинки девушка Скорпион выберет мужчину с красотой, отменным вкусом, умом и уверенностью в себе. Ей нужен компаньон, с которым она будет чувствовать себя слабой и уязвимой.

    Он, в свою очередь, должен вселить в нее уверенность в том, что она уникальна для него и единственная на всю жизнь. И в то же время она выступит хорошим советчиком и помощником. Социальный статус и карьера мужа для нее ничего не значат.

    Девочки-Скорпионы очень беспокоятся о своей физической форме на протяжении всей жизни, и даже возраст им не помеха.

    Знак зодиака женщина Скорпион — характеристика

    Характеристика женщины по знаку гороскопа Скорпион может быть описана следующими эпитетами:

    • тайна красоты;
    • привлекательный внешний вид и движение;
    • независимость;
    • гордость и уверенность в себе.

    Характеристика девушки-Скорпиона также может быть описана как ранняя женственность, обаяние и соблазнительность. Девочки этого знака уже с подросткового возраста понимают свое внутреннее превосходство над сверстницами, но при этом умеют скрывать свое отношение и очень искренне ведут себя как нежное и доброе существо, контролирующее чувство доминирования.

    Женщина Скорпион — характеристика в любви

    В любовных отношениях женщины этого знака довольно непредсказуемы.Любимого Скорпиона может очень поразить перемена в поведении. Но это не страшно, мужчины по-прежнему любят таких представительниц слабого пола. В стремлении привлечь внимание мужчины женщина-Скорпион умело использует все доступные средства: тонкий аромат духов, взгляды, другие методы и способы.

    Такая женщина точно знает, что ей обязательно протянут руку, откроют дверь машины, поднесут к сигарете спичку или зажигалку. Она сможет очаровать любого мужчину и сделать его счастливым или несчастным в любви, все зависит от ее желания.С ней не стыдно и на светском мероприятии появиться, и в саду поработать. Она привлечет к себе внимание и в джинсовом костюме, и в вечернем платье, и в повседневной одежде.

    Из других особенностей женщины-Скорпиона в любовных отношениях следует выделить ее удивительную способность буквально насквозь проникать в человека взглядом и прекрасно понимать его настоящие намерения и желания. Другими словами, вы можете засыпать ее цветами и читать ей стихи до утра, но при этом она точно будет знать о настоящих желаниях и мотивах такого мужчины.Кстати, стоит отметить, что такую ​​же характеристику можно дать девушке — Скорпион в любви.

    Еще одной важной чертой женщины-Скорпиона является ее склонность к способностям черной магии. Иногда она может напоминать ведьму или волшебницу. Каждый мужчина сможет ощутить ее влияние на себе. В этом случае результатом будет одно из двух – либо сильнейшее желание сбежать от такой женщины, либо полностью попасть под ее обаяние.

    Особенности характеристики девушки по знаку зодиака Скорпион в любовных отношениях

    Как было отмечено выше, девушке-Скорпиону в полной мере свойственны все черты, которые присущи женщине-Скорпиону.Справедливости ради отметим, что она полностью их освоит, когда превратится в настоящую женщину.

    Девушка этого знака никогда не простит и не будет со слабым мужчиной. Ее избранники должны отличаться отвагой, бесстрашием и непримиримыми амбициями. Он может доминировать в любви, но никогда не сможет полностью подчинить себе такую ​​девушку. Его основные характеристики:

    Мужчина, избранный девушкой-Скорпионом, должен быть во всем лучше остальных представителей мужского пола. Если девушка все же выберет своего избранника, то он сразу почувствует себя уникальным и необычным, чем-то выделяющимся из толпы.Девушка в силу своей неопытности сможет по-настоящему увлечься им, всячески угодить ему и исполнить почти все желания, она сможет выразить всю свою страсть. По этой причине нетрудно догадаться, почему близкие Скорпионы чувствуют себя по-настоящему счастливыми. Это общая характеристика Скорпионов, а точнее, женщин этого знака зодиака.

    Женщина — знак зодиака Скорпион

    Женщина-Скорпион – умная, хитрая, ловкая натура. Она умеет преподнести свою красоту, воспользоваться талантом актрисы, показать напор, напор, активные действия.Она экстремальная, непредсказуемая натура. Он может впадать в крайности, увлекается до фанатизма, создает себе несуществующие идеалы.

    23 октября — 21 ноября

    знак зодиака Скорпион

    Женщина-Скорпион, как правило, проходит через множество испытаний, но благодаря ее огромному физическому и духовному потенциалу ее силу духа очень трудно сломить. После поражений, если таковые имеются, представительница этого знака не сдается, не сдается, не теряет былого запала и быстро приходит в себя, возвращаясь на прежние позиции.Женственность, изящные манеры, кокетливость, соблазнительность, крайняя привлекательность делают Скорпиона женщиной, которую называют роковой.

    Личность женщины — Знак зодиака Скорпион

    Женщина-Скорпион якобы содержит в себе все качества, которые привлекали мужчин со времен сотворения мира: обаяние, чувство собственного достоинства, страстность, Таинственность. Так что неудивительно, если вы очаруетесь ею с первого взгляда. Женщина-Скорпион обладает многими чертами характера, присущими только мужчинам. Но это не мешает ей выглядеть и чувствовать себя очаровательной дамой.Этот знак зодиака знает о своей харизме и привлекательности и активно этим пользуется. Представительницу этого астрологического периода часто называют роковой женщиной. Она, действительно, способна кардинально изменить судьбу близкого ей человека. Черты, составляющие характер женщины этого знака зодиака, очень ярко выражены. В моменты депрессии или неудач Скорпион может потерять самообладание и направить энергию в негативное русло. В этом случае все ее силы, ранее приводившие к финансовому и личному успеху, будут направлены на саморазрушение.Так что, какой бы сильной ни казалась женщина-Скорпион, ей нужна поддержка и помощь в сложных ситуациях.

    Преимущества женщины-Скорпиона

    Женщины, рожденные под знаком Скорпиона, очень часто отличаются повышенной эмоциональностью и искренностью. Скорпионы практичны, обладают несомненным магнетизмом, притягивают окружающих своей мистической натурой. Как правило, Скорпионы добрые люди, и их доброта носит деятельный характер, им свойственны такие черты, как решительность, самодисциплина, настойчивость, энергичность.Скорпионы очень искренние, верные; всегда стараются добиваться наилучших результатов во всем, что делают, стремятся повышать свое профессиональное мастерство. Скорпионы прирожденные бойцы, завидуют успехам других людей, часто участвуют в различных соревнованиях.

    Слабые стороны женщины-Скорпиона

    Тайная слабость женщины-Скорпиона — преклонение перед умом. Людям с высоким уровнем интеллекта скорпионы могут позволить даже слишком много — командовать собой. Но это влияние не является долговременным или постоянным, потому что сам скорпион не остается в стороне от образования и философии.У женщины-Скорпиона сложная, постоянно трансформирующаяся психика. Она поедает себя изнутри, проживая все свои чувства, раз за разом переигрывая ситуации. Все Скорпионы любят деньги, роскошь и со всей страстностью своей натуры. При этом женщина, рожденная под этим знаком зодиака, может как с энтузиазмом копить их, так и с такой же страстью тратить.

    Влюбленная женщина Скорпион

    Она из тех роковых женщин, у которых любовные отношения складываются непросто, всегда много запретов, противоречий.Она может разрушить семью, увести мужа из семьи, поссорить будущего избранника с его семьей, разорвать связи с друзьями. В борьбе за сердце мужчины она безжалостная соперница, которая будет использовать все возможные уловки и женские уловки. Скорпионы всегда и при любых обстоятельствах будут иметь сильный характер и глубокую потребность в любви. В любви вся цельность и сила ее светлой натуры проявляется как нельзя лучше. Ради любви она готова на многое — даже на то, чтобы отдать мужу ведущую роль в семье.Ведь, несмотря на свои лидерские качества, она хочет быть женой настоящего мужчины, а не подкаблучника. Девушка-Скорпион очень ценит интимную сторону отношений. Ее чувственность, страстность, любовь к постельным экспериментам доставляют неземное наслаждение. В делах сердечных редкий Скорпион спрашивает у кого-то совета или делится своими сокровенными планами. В сфере любви и брака, брака и интима они прекрасно разбираются сами и совершенно не нуждаются ни в каких посторонних подсказках. При подборе и выборе партнера в любви и браке их чутье работает на высшем уровне, подкрепленное хорошо развитым внутренним голосом.

    Женщина Скорпион в браке и семье

    Для своего мужа женщина-Скорпион выступает такой же помощницей, хорошим советчиком. Карьера мужа, его общественное положение для нее не пустой звук. Она готова положить любые жертвы на алтарь успеха мужа, готова поддержать его всем присущим ей умом и энергией. С этой точки зрения ее, несомненно, можно назвать верной женой. Дома у женщины-Скорпиона всегда царит безупречная чистота, жизнь в нем комфортна, а интерьер создан таким образом, что не оставляет сомнений в превосходном вкусе хозяйки и любви, которую она испытывает к своему дому.Разводы крайне редки, но и вдовы далеко не редкость. Если по каким-то причинам они не женятся (что случается не часто), то все свои силы и энергию, любовь и страсть они вкладывают в работу. Из женщин, рожденных под этим зодиакальным созвездием, выходят хорошие матери, которые, с одной стороны, развивают их волю, жизнелюбие, подготавливают к трудной будущей жизни, а с другой — создают благоприятные условия для проявления задатков и талантов. Скорпионы большие знатоки человеческой натуры, и это их качество находит применение в воспитании детей.Мамы, рожденные под этим созвездием, помогают детям решать их проблемы, анализируют сложные ситуации, выбирают достойных друзей, дают дельные советы.

    Женщина знака зодиака Скорпион: гороскоп и характеристика

    Женщина-Скорпион – самоуверенная дама, обладающая загадочностью и уверенностью в своих силах. Эта дама просто переполнена энергией и старается браться за самые сложные задачи и проекты.

    Представитель этого знака постоянно ищет приключений и новых ощущений. Она по праву считается роковой женщиной, так как невероятной силой притягивает к себе представителей противоположного пола.

    Мужчины готовы сделать для этой дамы практически все, пожертвовать и карьерой, и домом, но она не против. Но следует понимать, что такая игра может быть очень опасной, так как может превратить мужчину в настоящего раба.

    Для себя женщина знака зодиака Скорпион выбирает смелого и страстного мужчину, который сможет стать настоящим союзником на всю жизнь.

    Представительница этого знака зодиака обожает роскошь денег, которые любит не только копить, но и тратить, и явно предпочтет в качестве спутника жизни того, кто умеет хорошо зарабатывать.

    Женщина Скорпион: характеристика

    К выбору друзей, как и второй половинки, женщина-Скорпион подходит с особой серьезностью, так как представительница этого знака никогда никого не подпустит к себе, а если она выбрала вас, у вас есть все основания гордиться собой.

    Эта женщина бросается из крайности в крайность, но помните — она ​​любит или ненавидит, смеется или плачет, она искренна в проявлении своих чувств.

    Представительница этого знака умеет скрывать свои переживания и страхи, а плакать она позволяет себе только в крайних случаях, и то в одиночестве.

    Несмотря на то, что она хранит секреты своих друзей и поддерживает их во всем, предпочитает ни с кем не делиться своими проблемами и секретами.

    Черты характера женщины-Скорпиона

    Характер женщины-Скорпиона таков, что она никогда не позволяет себя обидеть или обмануть.Она невероятно умна и очень горда. Если кто-то встанет у нее на пути, ему не поздоровится, ведь только Скорпион может мстить и жалить так безжалостно.

    В доме этой хозяйки всегда чисто и уютно, а ее дети талантливы и целеустремленны. Она умеет воспитать и направить своего ребенка в нужное русло, учит решать свои проблемы самостоятельно.

    В качестве жены девушка Скорпион — отличный компаньон и советчик. Она верна своему партнеру духовно, хотя если говорить о физических отношениях, то здесь все совсем иначе.

    Даже если муж такой же страстный и темпераментный, не факт, что она сохранит верность, так как не может устоять перед возможностью насладиться новыми эротическими впечатлениями.

    Скорпион: характеристики и описание

    Узнайте все самое интересное о Скорпионе. Эта информация поможет вам добиться успеха в отношениях с представителем этого знака, избежать ссор и найти общие интересы.

    Скорпион совместимость с другими знаками зодиака

    Гороскоп для других знаков зодиака

    Гороскоп женщина Скорпион: комментарии

    Согласны ли вы с тем, что написано в статье «Гороскоп женщины-Скорпиона»? Напишите свой комментарий!

    Комментариев — 7, на странице «Гороскоп женщины»

    Я сам Скорпион, и несколько девушек, которых я знаю, были Скорпионами.Скорпион действительно очень сложный знак зодиака. Женщины-Скорпионы являются объектом мужской страсти, несмотря на то, что характер довольно агрессивный и своенравный. У меня есть только один близкий, проверенный временем друг. И я очень ценю нашу с ней дружбу. Мне трудно ладить с девушками, потому что я вижу лесть, фальшь, и не хочу делать вид, что они мне нравятся. Насчет супружеской верности тоже согласен. Я люблю своего мужа, но мне постоянно хочется новых ощущений и мысли часто о неверности, хотя пока что я верна своему мужу.

    Многое верно, но, женщина-Скорпион ненавидит готовить и убираться, я от себя и за многих ее друзей говорю скорпионам.

    Здравствуйте, я тоже скорпион, но люблю готовить с кухни, я бы точно не лез

    Да, я очень тщательно выбираю друзей и подруг, у меня их много, но настоящей я могу назвать только одну, проверенную годами. Это правда, что мы верны скорпионам своим мужьям и являемся и другом, и любовником, и женой, и партнером.Я не люблю, когда нас обманывают, и когда мы это видим, я держусь от таких людей подальше. Сам я тоже стараюсь держать себя в руках, быть искренним и не лгать людям.

    Как и все здесь пишут, я по гороскопу скорпион. Я совершенно со всем не согласен, потому что каждый человек индивидуален. Например, возьмем трудолюбивого человека — о себе такого не могу сказать, не люблю убирать, готовить и т.д., но люблю, чтобы было чисто, не скажу, что я руководитель, но некоторые лидерские качества все же присутствуют.Один близкий друг, а другие просто для общения и каких-то целей (как-то было не жестко, но так и есть), потому что они делают это одинаково. Почему-то я очень редко встречаю скорпионов по знаку зодиака.

    Не буду оригинален, я скорпион. У меня много знакомых скорпионов: мама, сестра, племянница, еще двоюродный брат, брат и еще несколько коллег по предыдущей работе; Могу судить о соответствии описания реальным персонажам. Конечно, у всех есть общие черты.Именно — любовь и потребность в любви. Насчет измены, не знаю как другие, но я верна своему мужу (замужем 12 лет). К выбору мужа подошла ответственно и со всей серьезностью, подружек много, да, нет. Один из университета, остальные просто хорошие друзья. Ненавижу убираться и готовить, хотя иногда хочется, не чаще раза в месяц. Я не ненавижу о себе, я вообще не питаю этого чувства, иногда я злюсь, даже злюсь))), но я никого не ненавижу, хотя есть причины, я просто вычеркиваю человека из моя жизнь и даже не поздороваться.Я не мщу целенаправленно, но если есть возможность подставить того, кто вел себя со мной некорректно, я не премину ею воспользоваться.

    Я скорпион по гороскопу и почти согласен с вышесказанным, очень горжусь собой и не позволю себя обидеть. Люблю готовить, убираться, а насчет измены это не про меня, я верен любимой.

    Знак зодиака Скорпион

    СКОРПИОН (24.10-22.11) — ЗНАК ЗОДИАКА

    ХАРАКТЕРИСТИКИ ЗНАКА ЗОДИАКА СКОРПИОН

    Укус Скорпион обычно смертелен.

    Скорпион очень хорошо умеет управлять своим характером, но есть признаки, по которым можно узнать этих людей. Их глаза излучают гипноз, взгляд этих людей проникает глубоко в вас. В общем, Скорпион — это выражение ЭГО. Они прекрасно знают себе цену и ничто не изменит его собственного мнения о себе. Оскорбления от них отскакивают, а комплименты могут не вызывать никаких эмоций или каких-либо других изменений на их лицах. Они не хотят слышать о своих пороках или недостатках от других – они знают о себе все.Улыбка у них искренняя, реакция организма сведена к минимуму, т.к. их искусство заключается в том, чтобы проникнуть в вашу душу, не будучи узнанным. Будьте настороже со Скорпионами, так как внешне они могут производить впечатление мягких и наивных людей. Многие из них знают, что их глаза выражают их характер, поэтому стараются носить темные очки. Никогда не спрашивайте их мнения или совета, так как в ответ вы услышите голую правду, и она может вам не понравиться. Они никогда не льстят, а если говорят что-то приятное, цените это, потому что наверняка сказано искренне.

    Но не верьте, что Скорпион думает только о себе — он может помочь вам и словом, и делом, обычно они привлекают к себе либо преданных поклонников, либо завистливых и злобных врагов. Но даже враги уважают Скорпиона и хорошо отзываются о нем. Есть что-то хорошее в этих людях. Типичный Скорпион редко чего боится. Обычно это смелые и бесстрашные люди. Они удивительно верные друзья. Ради друга они могут пойти на многое. Они никогда не забудут проявленной к нему доброты или подарка, но соответственно никогда не забудут нанесенной кем-то обиды или раны.Они могут спланировать свою месть или немедленно ударить своим жалом, но чаще всего они планируют.

    Здоровье Скорпиона может быть подорвано меланхолией или тяжелой работой. Но у этого знака есть способность восстанавливать свое здоровье по желанию, если таковое имеется. Обычно они редко болеют, но болеют, как правило, тяжело, нуждаются в длительном отдыхе и внимательном отношении, всегда знают о своей болезни больше, чем лечащие их врачи и медсестры. Они склонны к заболеваниям горла, спины, сердца, кровеносной системы, ног.Они очень часто получают травмы в спорте. Они должны избегать пожаров, взрывов, радиации.

    Это героические личности, очень привязаны к семье, любят защищать слабых и детей. Среди них либо святые, либо грешники. Они яростно проявляют собственнический инстинкт к тому, что считают своей собственностью. Скорпион может сделать почти все, чего он действительно хочет достичь. Волшебная и таинственная сила Плутона превращает его желания в реальность. Скорпион знает секреты жизни и смерти, и у него есть возможность выиграть и то, и другое, если он захочет.Но астрология предупреждает его, что он не должен знать больше, чем знает.

    Ему удается почти все без особых усилий. Это больше похоже на удачу, чем на проявление собственной воли. Одна из самых странных вещей в астрологии заключается в том, что кто-то в семье умирает либо за год до своего рождения, либо через год после его рождения. А когда Скорпион умирает, то в его семье кто-то рождается либо за год до его смерти, либо через год. Это происходит не менее чем в 95 процентах случаев. Этим и объясняется тот факт, что символом Плутона является птица Феникс, возрождающаяся из пепла, а Скорпион олицетворяет возрождение.Сталь Скорпиона раскалена докрасна и закалена в печи, затем становится холодной и достаточно прочной, чтобы контролировать огонь его души.

    ЗНАК ЗОДИАКА СКОРПИОН-МУЖЧИНА

    ХАРАКТЕРИСТИКА ЗНАКА ЗОДИАКА

    Если вы влюбились в Скорпиона и вас пугает слово страсть, надевайте кроссовки и бегите так быстро, как за вами гонится сам дьявол. Так оно и есть. Я не имею в виду романтическую страсть, хотя она может привести ко всему. Скорпион страстный во всем: дружбе, политике, работе, еде, детях, родственниках.Это не тот человек, который подходит вашей психике, если эмоциональный стресс вас отталкивает. Не оглядывайся — лучше беги!

    Вы подумаете, что я сошел с ума, когда встретите этого человека. Настолько он производит впечатление человека ровного и спокойного. И как можно подозревать, что человек с таким самообладанием может быть страстным и даже опасно страстным? Это потому, что он спокоен только на поверхности, внутри его страсти горячи. Не трогай его — ты прекрасно знаешь, как долго заживают ожоговые раны.После встречи со Скорпионом у вас может болеть сердце месяцами, а то и годами. И все машины скорой помощи бесполезны.

    Вспомните любимую поговорку вашей бабушки: «Лучше 7 раз отмерить, чем один раз отрезать». Имеется в виду жало Скорпиона. Поэтому подумайте лучше о своей безопасности. Твердо знайте, с кем имеете дело. Если собственный знак дал вам железобетонную натуру, которая не боится огня, то смело увлекайтесь и играйте с этим динамитом.Если у вас есть такая натура, то вы можете держать его пламя в узде и сделать так, чтобы оно всю жизнь согревало ваше сердце. Возможно, вы сами являетесь жгучей натурой, тогда все в порядке. Дальше все будет зависеть от степени нагрева, если у ваших страстей есть автоматический термостат, который моментально охладит их, когда его страсти разгорятся.

    Давай представим, что ты и есть эта природа. Что скрывается за этими гипнотическими, пронзительными глазами Скорпиона? Наверняка он не произвел на вас нейтрального впечатления при первом знакомстве.Либо вы думали, что он милый и веселый, либо что он был извращенным и страстным человеком. Проблема в том, что он и то, и другое. Этот человек непобедим. За его холодной сдержанностью спрятан кипящий котел, который постоянно бурлит. Если повезет, то крышка этого котла надолго останется закрытой. Но удар по его самолюбию может взорвать этот котел. Иногда приятно чувствовать, что тебя не застал этот взрыв. Никогда не делайте сами ничего, что могло бы вызвать взрыв.

    Скорпион поразит вас своей двойственностью: в нем сочетаются ум и страсть.Интеллект и эмоции управляют им одинаково. Он более чем умен. Это глубоко философская натура, интересующаяся тайнами жизни и приближающаяся к ответам. Есть Скорпионы, которые могут жить без всякого комфорта, но истинная природа этого знака — чувственность. Обычно он окружает себя роскошью. Он склонен к излишествам в еде, наркотиках, алкоголе и, конечно же, в любви. Любовь никогда не застает его неподготовленным. Она уже была у него в голове, когда он впервые сел на трехколесный велосипед. Конечно, можно встретить Скорпиона, который будет выглядеть совершенно невинно, с обезоруживающим юношеским обаянием и полным отсутствием соблазнительных манер.Вам может показаться, что я преувеличиваю его страсть. Тогда спроси у его жены. Ничто не оставляет его равнодушным в жизни. У этих мужчин взрывной темперамент, способный ранить на всю жизнь. Когда он втыкает жало, это очень больно. Но он не просто наслаждается победой, он должен победить. Что-то внутри него умирает, когда он проигрывает даже в действиях. Когда он разочарован, вы не увидите эмоций на его лице, он очень хорошо владеет собой. Он может жестоко пытать женщину, прежде чем решиться схватить ее за волосы и утащить в свои джунгли.

    Естественно, есть некоторые Скорпионы, которые изящно сделают вам предложение на коленях, но не дайте себя одурачить, он просто ведет себя социально приемлемым образом и хочет сохранить свое достоинство. Ваша репутация должна быть безупречной. Он не терпит ничего дешевого и смехотворного, несмотря на свою экзотическую натуру.

    Каждый Скорпион является законодателем внутри себя. Ему совершенно безразлично, что о нем думают другие. Конечно, он хотел бы быть уважаемым человеком, но если это мешает ему реализовать свои цели, то его это не волнует.Ни одно его решение не откладывается под давлением мнения друзей, родственников, соседей и, к сожалению, под вашим давлением. Но подождите, отчаяние, такая решимость обычно порождает привлекательный, свободный дух, которому все равно, что говорят о нем другие люди. Честность и мужество — это плохо? Очень интересно наблюдать за Скорпионом, когда он действует в каких-то сложных обстоятельствах в то время, когда другие колеблются, боятся или не знают, что делать. Его мужественный и сильный характер достигает своего пика в такие моменты.Он редко ревнует и жалеет себя. И он не верит, что жизнь и ее трудности — это именно то, для чего он рожден. У него есть одна очень пугающая черта — его влекут тайны, загадки, он не упустит ни одной из них. А так как женская тайна является сильнейшей женской защитой, то ваша душа будет постоянно подвергаться ему, если вы откроетесь ему полностью. У вас не будет перед его глазами ни одной тайны и каверзных вопросов.

    У него очень высокие стандарты, и он тщательно выбирает себе друзей.Это редкий тип мужчин, которые могут пить чистый алкоголь и делиться грубыми мужскими шутками, а потом превратиться в нежного и нежного любовника для женщины. Но с другой стороны, у него нет такого качества, как прощать, подчиняться чему-либо или просто быть осторожным. Он может быть очень жестоким по совершенно необъяснимым причинам и может получать садистское удовольствие, издеваясь над вами. На публике, на публике он может сказать вам что-нибудь нелестное, например, что вы толстая или глупая. Это одно из его развлечений.Улыбнитесь в ответ, даже если это убьет вас. Ведь я вас предупреждал, что Скорпион не раскрывает своих мотивов что-то делать. И эта склонность к жестокости не усмиряется любовью; она может даже усилиться с годами. Он редко показывает свои истинные эмоции перед всеми, но вместе с вами может сказать то, что думает на самом деле. После замужества можно почувствовать некую защищенность. Но до этого момента все его выходки могут вас очень сильно задеть. Бесполезно говорить ему, что вас задевает его жестокое поведение.В этом случае он скажет вам: «Я вас не держу». Потребуется время, чтобы приспособиться к его личности.

    Если вы слишком нежны, то будете постоянно переживать. Никогда не спрашивайте его, что он думает о вашем новом платье или прическе, если вы не готовы услышать голую, голую правду. Но по крайней мере вы будете знать, что он вам не льстит. И, наверное, лучше услышать смелую правду, а время от времени приятные фразы в свой адрес, которые вам очень понравятся. Когда дело доходит до ревности, здесь нужно быть очень осторожным.Он взорвется, если ты просто моргнешь глазом в присутствии другого мужчины, хотя на самом деле в этот момент тебе в глаз попала соринка. Но лучше упакуйте свою ревность в чемодан и заприте его. Ваши слезы и упреки не произведут на него никакого впечатления. И как бы он ни себя вел, повторяйте постоянно про себя: «Он любит меня, он верен своим глубоким чувствам, он практикует свое гипнотическое искусство только с другими женщинами». Говорите себе это каждый день, особенно перед сном. Женщины находят его неотразимым и привлекательным.Но помните, что если кто и может устоять перед таким вниманием со стороны женщин, то это ваш Скорпион. Вы чувствуете себя лучше сейчас?

    Возможно, он будет очень требовательным отцом. Его дети не смогут быть ленивыми и непослушными. Он научит их уважать себя. И хотя он любит их искренней любовью, как и все остальное, он будет защищать их, но в то же время будет учить самостоятельности.

    Скорпион никогда не позволит жене что-либо ему диктовать.Он мужчина, а ты женщина. Если у вас есть какие-то сомнения по этому поводу, он быстро устранит их, и это займет всего один урок. Однако с понимающей его женой он будет нежным и внимательным и отплатит ей верностью и такой любовью, о которой многие женщины только читали романы. Не пытайтесь сопротивляться этому мужчине, если он решил, что вы ему нужны, он все равно вас загипнотизирует. Его магнетизм почти физически ощутим. Женщина должна быть очень смелой, чтобы жить с ним и не сломаться.

    Держись крепче, чтобы не упасть и широко раскрыв глаза, и ты увидишь горизонт, недоступный робким.Взгляните на деревья, вы когда-нибудь видели, как восходит солнце?! И с такой высоты? Его закат будет таким же прекрасным.

    ЗНАК ЗОДИАКА СКОРПИОН-ЖЕНЩИНА

    ХАРАКТЕРИСТИКИ ЗНАКА ЗОДИАКА

    Она обладает глубокой таинственной красотой. Она привлекательна, горда и абсолютно уверена в себе. Она втайне сожалеет, что не родилась мужчиной. Но она уверена, что является выражением истинной женственности. Она достаточно обаятельна и очень соблазнительна. Но я не говорю, что она похожа на мужчину.Просто она предпочла бы быть мужчиной подсознательно, иметь больше возможностей, чем обаяния. Но она не признается в этом даже самой себе. Женщина-Скорпион смотрит свысока на тех женщин, которым подходит роль нежной женщины и матери. Но она умеет контролировать свое желание доминировать, прекрасно выступая в роли женского существа. И делает это с большим изяществом, чем знаки, в которых (Овен, Лев, Стрелец) есть и мужская сторона.

    Иногда мужчину может удивить изменение ее поведения.Она умеет преподнести свою натуру в нужный момент и привлечь мужчину тонкими ароматами, экзотическими взглядами и прочими ухищрениями. Она очень хорошо знает, что нельзя зажигать сигаретную спичку или пускать дым вам в лицо. Она будет двигаться к вам медленно, соблазнительно, бесшумно, окутывая вас своим очарованием. Эта женщина хорошо выглядит в джинсах и кроссовках. Вы не должны ожидать, что она будет слепо обожать вас. Она прекрасно понимает, что у тебя на уме. Вы можете шепнуть что-нибудь романтическое на ухо другой женщине, и Скорпион просто посмотрит на вас своим пронзительным взглядом и сразу поймет все ваши истинные намерения.Эта женщина — настоящий рентгеновский аппарат. Поэтому не стоит с ней играть. Если вы относитесь к этому несерьезно, вы тратите ее время и тем самым обижаете ее. И я бы вам этого не советовал.

    Могу сказать, что эта настоящая роковая женщина умеет скрывать свою натуру за очаровательной улыбкой, хорошими манерами, тихим голосом, казаться ангельской. Но вам нужно быть начеку. Она может быть властной, саркастичной, а потом горячей до 100 градусов, а может очень вас ненавидеть, но может и очень вас любить.У этой женщины есть дар вызывать мурашки по коже. Она владеет почти черной магией и использует ее так ловко, что иногда кажется настоящей ведьмой. Благодаря своему мистическому чутью она очень часто может с первого взгляда узнать своего будущего партнера. Естественно, вы почувствуете его влияние на себе. При этом у вас может быть две реакции: либо вы будете полностью охвачены ее обаянием, либо у вас возникнет желание убежать. Подожди немного — она ​​может многому тебя научить. В любом случае, вы должны считать себя польщенным ее интересом к вам.

    Она не признает в мужчине слабостей. Ей нужен мужчина с амбициями и мужеством. Он должен доминировать над ней, но в то же время она должна уметь сохранять свою индивидуальность. Он должен быть сильным, мужественным и выглядеть лучше других, обладать высокоразвитым интеллектом больше, чем простое знание философских трудов. Вы будете думать, что вы выше других, потому что она обратила на вас внимание, ваши ставки сильно повысятся. Сблизившись с ней, вы почувствуете себя уникальным и необычным человеком.Наверняка, ее любовь не сравнится с вашими прежними увлечениями. Вы будете ее самым главным увлечением и интересом в жизни. Она постарается угодить вам всей своей страстной напористостью. Видимо, слово «страстный» уже привлекло ваше внимание.

    Большинство мужчин уже слышали волнующие слухи о страсти этих женщин. Правда, внутри она горит страстью, которую держит под контролем. При этом она проявляет холодное отношение к незнакомым людям, а ее внешнее спокойствие напоминает черный бархат.Но человек, слово «страсть» относится только к любви. Для этой женщины такое определение не подходит.

    Страсть присутствует во всех ее делах и поступках. Она никогда не просто интересовалась. Невозможно представить ее равнодушной. Ей редко что-то нравится или не нравится, она либо полностью отрицает, обожает, либо игнорирует. Однако на поверхности она остается спокойной. У нее много достоинств, но могут быть и сильные недостатки. Поэтому вам лучше подумать о ее достоинствах, так как ее привлекает изучение всех темных сторон.Поскольку у нее нет страхов, ее исследования могут зайти слишком далеко.

    Но типичная женщина-Скорпион всегда остается сильной и чистой. Она может многое испытать в жизни и обогатить свои знания и опыт. Но как-то к ней не липнут подозрения и слухи, она остается выше других женщин. Она может хранить чужие секреты, хотя на собственной душе можно повесить табличку «Посторонним вход воспрещен». Она любит выслушивать тайны, но сама никому не признается. Не пытайтесь узнать ее тайны — у нее есть часть души, которую не стоит трогать и которая принадлежит только ей.Это не значит, что она неискренняя или лживая, наоборот! Но есть вещи, о которых она никогда никому не расскажет.

    Очень предана тем, кого считает сильным и заслуживающим внимания, уважения. Но она даже взглядом не удостоит слабого. Достоинство, которое она поддерживает в отношениях, иногда делает ее снобисткой и несколько отчужденной. В какой-то степени это так. Она придерживается собственной кастовой системы, которая более выражена, чем у других женщин. Все Скорпионы очень избирательны в дружбе.Постоянного друга она сохранит на всю жизнь, но заморозит отношения с мелкими и неинтересными людьми. У нее отличная целеустремленность и выносливость. Это помогает ей преодолеть многие искушения, например, пристрастие к алкоголю, наркотикам, депрессию. Ей нужно быть законной женой, чтобы приносить любовь и ласку мужчине.

    Если обстоятельства помешают вам выйти замуж, она будет любить вас, что бы ни говорили соседи. И часто эти отношения лучше, честнее, чем в браке.У нее свои законы. Несмотря на свою сильную личность, она позволяет мужчине быть хозяином и помогает ему добиваться поставленных целей. Ей будет важно ваше будущее, она может пожертвовать ради этого своей карьерой. Она может бороться с вами наедине, но яростно защищать вас на публике. Ваше счастье для нее на первом месте. Она будет терпеливо помогать вам во всем, не будет ныть и жаловаться. Она любит свой дом, где царят чистота, вкус и уют. Еду подают вовремя, все в порядке.

    Для женщины-Скорпиона генеральная уборка — как отпуск.Она любит убирать углы, но старайтесь не находить нотки, пахнущие духами. Она очень подозрительна, даже когда нет причин. Так что будьте осторожны. Не стоит ее подозревать, хотя дел для этого у вас будет много. И вы захотите задать ей несколько вопросов. Лучше проглоти их. На ваши вопросы не будет ответа. Вы говорите, что это несправедливо, но она справедлива. Живи с ней или уходи от нее, возможно ты останешься с ней, т.к. оставить его практически невозможно. Она будет в твоем сердце всю жизнь.Лучше подстроиться под ее характер. От женщины-Скорпиона никто не уходит. Разве ты этого не знал? Тогда пусть те, кто оставил ее, научат вас кое-чему.

    Ей часто не хватает способности держать рот на замке и сдерживать резкий тон, анализируя что-то и кого-то. Когда дело доходит до бюджета, ее поведение непредсказуемо. Она может откладывать деньги, тогда она становится транжирой. Но одно можно сказать точно — деньги доставляют ей удовольствие. Она заботится о престиже, поэтому не любит безденежья. Она любит власть.Помните, что она слишком горда, чтобы жить в среде, которая ей не подходит, но ради вас она может это сделать, если это поможет вашей карьере. Она либо постарается поправить свое материальное положение, либо сделает вид, что бедность доставляет ей удовольствие, но внутри себя будет глубоко несчастна.

    Она может быть собственником, но никому не позволит считать себя чужой собственностью. Одна из ее худших черт — нежелание принимать чью-либо точку зрения, кроме своей собственной, когда ее нервы на пределе.В разгар ссоры с ней нужно помнить, что она всегда стремится быть победительницей. Последнее слово должно оставаться за ней. Если ты солжешь ей хотя бы раз, она солжет тебе дважды. Если ты не поцеловал ее на ночь после ссоры, она не будет целовать тебя целый месяц. Ее чувство справедливости столь же сильно, как и ее чувство мстительности. Большинство людей забывают об этом. Она вспомнит все хорошее, что вы ей сделали, и в ответ на вашу доброту ответит вдвойне.

    С детьми ее выражение любви может быть лишено нежности. Она научит их смелости, но может быть слепа к их недостаткам. Иногда женщина-Скорпион может утопить вас в своих страстях, но в настоящую бурю ее ум и стальная воля окажутся спасительными. Она может быть немного опасной, но очень привлекательной. Когда будете пить кофе, попросите ее погадать на кофейной гуще. Она может, если захочет. Вы хотите сказать, что не знали этого? Но я сказал, что в ней есть что-то, что принадлежит только ей.

    ✔ Обо мне ✉ Отзыв

    Женщины-Скорпионы отличаются по-настоящему сильным, волевым характером. Они по натуре бойцы, ведь им покровительствует планета Марс. Из положительных качеств представителей этого знака зодиака можно назвать целеустремленность, честность, преданность своему делу и своему партнеру. Если ваша жена скорпион, вы можете положиться на нее на 100%. Если говорить о ее отношении к работе, то она закоренелый трудоголик и пока не сделает то, что нужно, ее не выгонят с рабочего места.Женщина-Скорпион – замечательная мать, которая заботится о своих детях даже тогда, когда их уже нельзя назвать детьми. Что же касается отрицательных качеств, то, в первую очередь, это самокритичность – ни один знак зодиака не умеет так выносить мозг, как этот; также можно отметить некий авторитаризм и полное отсутствие уважения к чужому мнению.

    Кажетта, ясновидящая.

    1. Женщины-Скорпионы сексуальнее других знаков зодиака

    Они не только чаще привлекают представителей противоположного знака, чем женщины других знаков зодиака, но и являются наиболее раскрепощенными.Также женщины-Скорпионы придают большое значение сексу в своей жизни. При этом их воображение может быть безграничным. Сексуальная совместимость с мужчиной для нее является одним из главных критериев, по которому она выбирает партнера. Если в сексе не все идеально, то построить с ней длительные отношения будет сложно. Многие мужчины могут даже не устоять перед такой требовательной, страстной, а порой даже ненасытной партнершей, каковой зачастую являются женщины-Скорпионы.

    1. Скорпионы всегда доминируют и контролируют ситуацию.

    Для близких это качество женщин-Скорпионов может быть как огромной ценностью, так и настоящим наказанием. Ее властный характер, с одной стороны, проявляется в безграничной заботе и опеке над членами семьи, детьми и второй половинкой. Но с другой стороны, они часто превращаются в настоящих тиранов. Женщина-Скорпион любит устанавливать в доме свои правила и редко идет на компромиссы. Когда что-то идет не так, как ей заблагорассудится, конфликта не избежать. Особенно это проявляется в воспитании детей.

    1. Скорпионы всегда побеждают

    Во всех сферах жизни эти женщины любят азарт и соревновательный момент. Демонстрировать себе и окружающим, на что они способны, для скорпионов огромное удовольствие. В связи с этим они нередко добиваются огромных успехов в спорте, способны завоевать сердце самого востребованного мужчины и занять лидирующие позиции в других сферах жизни. Конкуренция их никогда не пугает, а только стимулирует, так как они лидеры по натуре.При этом у них достаточно сил, целеустремленности и упорства для любых свершений.

    1. Скрыть свою конфиденциальность

    Они привыкли преодолевать все жизненные трудности самостоятельно, поэтому редко обращаются за советом к другим, и вообще посвящают их своим делам. Женщины-Скорпионы не любят говорить о своей семье, они делятся только тем, что считают нужным. Они хвастаются, что у них успешный муж, но вы никогда не узнаете о его недостатках.Она всегда будет позиционировать свою семью как самую большую ценность в своей жизни. Для женщин этого знака зодиака семья, дети, муж однозначно в приоритете. При этом она всегда будет заботиться о своих детях, заботиться не только о том, чтобы они были обуты и одеты, но и развивались.

    1. Очень любопытно

    Любопытство — не порок, а второе счастье. Именно так думает женщина-Скорпион, и в этом она права. Без необходимой доли любознательности не было бы сделано и сотой доли научных открытий! А женщина-Скорпион готова проявлять любопытство везде и всегда – и это не праздное качество, она не любит сплетен.Любопытство для нее является стимулом к ​​новым увлечениям, работе, знаниям. Благодаря ему они получают информацию.

    1. Одержим страшными вещами

    Скорпион – тот самый знак зодиака, которого мистицизм не пугает, а, наоборот, притягивает. Кому-то кажется, что они одержимы, на самом деле представители этого знака зодиака действительно верят во все волшебное. И стараются, по возможности, максимально добавить в свою жизнь это самое волшебство.Не удивляйтесь, что, придя в гости к женщине-скорпиону, вы обнаружите расставленные по углам массивные свечи и маленькое блюдце с молоком на столе — нет, это не для кота, а для домового. В кино она будет ходить только на ужастики, а по вечерам смотреть Хичкока.

    1. Любители черного юмора

    Женщинам-Скорпионам свойственны сарказм и привычка ко всему иронизировать. В этом проявляются и ее лидерские качества, и умение видеть людей насквозь.Причем иногда это проявляется в чересчур колких шутках и черный юмор им очень близок. Те, кто связан с ее жизнью, должны быть к этому готовы. Окружающие могут реагировать на это качество по-разному, но в основном люди из ее близкого окружения умеют смеяться над собой, иначе их пути разошлись бы из-за своеобразного чувства юмора женщины-Скорпиона.

    1. Им все равно, что о них думают другие.

    Женщины-Скорпионы обычно сильные и независимые.У них часто бывает много завистников, недоброжелателей, а также людей, так или иначе осуждающих их свободный нрав. Но они не придают никакого значения чужому мнению о себе. Главное для них — соответствовать собственному представлению о морали и этике. Во всех своих действиях они руководствуются только собственными принципами и редко уступают мнению большинства. Но если они в каких-то ситуациях учитывают чужое мнение, то всегда четко понимают, кто желает им добра и дает советы от души, а кто с ними неискренен.

    1. Очень честный

    Честность и искренность, пожалуй, главные достоинства женщины-Скорпиона. Они не умеют врать и даже не хотят учиться. Они не станут говорить вам незаслуженные комплименты, признаваться в любви, если не чувствуют ее. Вы всегда можете быть на 100% уверены в каждом сказанном вам слове, ведь в нем нет ни грамма лжи. Конечно, иногда любовь к правдивости идет им боком – там, где вроде бы приходится лгать, чтобы получить выгоду, они тоже не могут поступиться своими принципами.Таким образом можно потерять друзей и очень быстро нажить себе врагов, что, кстати, часто случается в жизни женщины-Скорпиона.

    1. Защитники слабых

    Недаром среди представителей этого знака зодиака так много юристов и врачей. Способность сочувствовать чужому горю, сопереживать и оказывать посильную помощь наиболее развита у представителей этого знака зодиака. Вспомните замечательный фильм «Эрин Брокович», где главную роль сыграла Джулия Робертс.Юля — скорпион, и в образ своей героини она вложила все черты, свойственные ей самой — стойкость, стойкость, решительность, при этом она была готова пройти через огонь, воду и медные трубы, чтобы помочь людям, остро нуждающимся в этой самой помощи. И она сделала это, как настоящая женщина-скорпион.

    1. Уметь хранить секреты
    1. Они умеют определять правду лучше, чем детектор лжи

    Женщину-скорпиона практически невозможно обмануть.Она сразу чувствует ложь, каким бы правдоподобным ты ни был. Особенно это касается членов ее семьи и близких людей. Например, дети с матерью-Скорпионом обычно с детства усваивают, что всегда лучше признать плохой поступок, чем пытаться придумать оправдание. Это связано с гибким аналитическим умом, который заставляет анализировать любую услышанную информацию. Кроме того, у женщин-Скорпионов хорошо развита интуиция и в их головах заложены основы психологии, поэтому не хотите ссориться – будьте всегда с ней честны.

    Просмотров сообщений: 0

    Привлекательная, хитрая, умная и загадочная женщина-Скорпион всю жизнь не дает покоя мужчинам и вызывает много пересудов в женских компаниях. Нет людей, которые на 100% соответствовали бы своему зодиакальному описанию, но основные черты и характеристики свойственны большинству. Скорпион очень интересен женщине.

    Сущность и характер

    Женщина под знаком зодиака Скорпион (24 октября — 22 ноября) априори знает, что она может вскружить голову любому мужчине, она полна энергии, уверенности в себе и сильного магнетизма .

    Если она пишет книгу по психологии о том, как вести себя, чтобы понравиться мужчине, такая работа просто обречена на успех … На фоне этого знака все остальные женщины в окружении мужчины просто меркнут, и он видит только ее одну. Это соблазнительная женщина, настоящая нимфа.

    Скорпионы во много раз энергичнее женщин других знаков зодиака, видимо, поэтому берутся за любые дела и слишком много работают. Она постоянно в движении, попав в ее компанию, вы точно не заскучаете, только немного устанете от ее бурной непрекращающейся деятельности.

    женщины-Скорпионы находятся под покровительством Марса, а они бойцы по натуре, обладают волевым, непреклонным и сильным характером … Также характеристика девушки-Скорпиона по гороскопу подразумевает, что они всегда честны , скрупулезны, целеустремленны и преданы своему делу.

    Детство девочки-Скорпиона

    Девушки этого знака с раннего детства обладают неповторимым обаянием … Все дается им с легкостью, окружающие тянутся к ним и часто идут на уступки.Даже в самом юном возрасте девушка-Скорпион с помощью своей природной хитрости и обаяния добивается быстрого получения сладостей и желанных игрушек.

    Они очень быстро взрослеют, часто полны всевозможных тревог и переживаний, скрытых в самой глубине души. Как правило, это приводит к ночным кошмарам и изоляции ребенка. Скорпионы боятся критики и очень болезненно переживают негативные оценки в их сторону .

    Талисманы и символы

    Стихия этого знака зодиака – Вода.Женщины-Скорпионы имеют особую связь с Луной, обладающей силой управлять подсознанием. Наиболее подходящими украшениями в качестве оберега являются:

    • серебряные изделия в виде луны или полумесяца;
    • пентаграммы и;
    • всевозможные изображения змеи, жука и скорпиона.

    Они будут не только служить талисманом, но и благодаря своей магической силе привлекать внимание мужского пола.

    Каменные амулеты издревле считались самыми действенными.Минералы обладают огромной энергией, которая хранится в них тысячи лет. Наиболее подходящими камнями-амулетами для женщины этого знака являются:

    • аквамарин;
    • малахит;
    • рубин;
    • коралловый;
    • берилл;
    • оникс;
    • топаз;
    • кошачий глаз.

    Любовь и отношения с мужчинами

    По натуре представители этого знака очень нежные, романтичные, эмоциональные и в то же время бесконечно требовательные.Любовь для Скорпиона крайне необходима. Ее интересуют серьезные отношения, а ни к чему не обязывающие флирт и связи на одну ночь для нее нехарактерны.

    Собственница до мозга костей, женщина-Скорпион требует от своего избранника полной самоотдачи и верности. Как правило, она с самого начала не скрывает своих жестких требований и условий, связанных с официальной регистрацией отношений.

    Ни один мужчина не потерпит необоснованной ревности и собственнического поведения.Однако бесконечно обаятельную и обольстительную представительницу этого знака все прощают. Своей загадочностью и непредсказуемостью она привлекает мужчину постоянно: в спальне, на работе, в компании друзей.

    Скорпион великолепный манипулятор, она способна одним словом довести до отчаяния и мимолетной улыбкой поднять из пепла.

    Совместимость женщины с представителями разных знаков зодиака:

    Довольно эротичная и раскрепощенная представительница этого знака не знает условностей в сексуальных отношениях.Она прекрасный партнер, у которого нет комплексов и табу.

    Женщина-Скорпион до самой старости будет следить за собой и стараться быть желанной, манящей и привлекательной для своего мужчины.

    Для нее секс — средство общения. Имея от природы сильное либидо, девушки-Скорпионы в раннем возрасте, гораздо раньше своих сверстниц, начинают интересоваться информацией о сексе и его отдельных аспектах.

    Избранному мужчине нужно быть готовым к незабываемому, интенсивному и где-то дикому сексуальному опыту со Скорпионом.

    Женщина будет матерью с довольно приземленными понятиями, она не позволит своему ребенку смотреть на мир через розовые очки, она научит его быть готовым к суровым реалиям, уметь защищаться и стоять на своем для себя. Такая агрессивная энергия пойдет детям только на пользу, уже в раннем возрасте формируя у них правильное восприятие окружающего мира.

    Даже в ситуации, когда воспитанием ребенка ей придется заниматься одной, благодаря своему сильному и волевому характеру женщина отлично справится с этой миссией, во многом заменив отцовских детей.Многогранная и переменчивая представительница этого знака может с лавинообразно обрушить на своего ребенка всю нежность, заботу и любовь, а через небольшой промежуток времени проявить излишнюю строгость и непреклонность в вопросах воспитания.

    Обладая высокоразвитым чувством собственности по отношению к своим детям, ей удаётся установить глубокую, почти телепатическую связь со своим ребёнком на долгое время.

    Работа и карьера

    Женщина под знаком Скорпиона может раскрыть свои лучшие качества в профессиональной деятельности.

    Ей сложно ужиться в роли подчиненной самого низкого уровня, благодаря своему трудолюбию и сильным амбициям она легко поднимается по карьерной лестнице до руководящих должностей. Обладает незаурядным умом, ответственна, самостоятельна, энергична, способна выйти из самой сложной ситуации, легко распознает ложь и лесть.

    Отличительная черта — секретность. Подчиненные и высшее руководство часто недолюбливают Скорпионов за это. Однако во многих профессиях такая черта характера будет неоспоримым плюсом.Скорпион чаще всего выбирает мужские специальности и преуспевает в таких профессиях, как:

    • следователь;
    • политик;
    • криминалист;
    • юрист;
    • адвокат.

    Обладает трезвым мышлением и проницательностью, благодаря огромному потенциалу часто строит успешную карьеру.

    Здоровье и сила

    Наиболее слабыми и неустойчивыми к болезням являются позвоночник, кровообращение и кожа.

    Во время сезонной эпидемии ОРВИ и гриппа у женщины больше шансов заразиться инфекцией.Несмотря на удивительную выносливость и активность, они часто выгорают, нередко страдают депрессиями и упадком жизненных сил, выйти из этого состояния достаточно сложно.

    Дружба и отношения

    Представители этого знака зодиака большие друзья. Они всегда придут на взаимопомощь, поддержат в трудной ситуации и подставят свое сильное плечо, открыты и честны, не склонны ко лжи, откровенной лести и зависти.

    Ей можно смело доверить любые тайны и секреты, рассказать о планах на будущее.Умеет выслушать и дать дельный совет. Однако не стоит ждать от нее ответной откровенности, Скорпионы редко делятся своими сокровенными мечтами.

    Говоря о том, какая на самом деле женщина-Скорпион, можно сказать, что она не прощает предательства и обид, не стоит обманывать и обсуждать ее за спиной, иначе можно потерять друга навсегда. Нужно постараться не обидеть эту женщину — она ​​не умеет прощать, а если обида сильная, способна на изощренную месть.Потеряв в ее лице друга, человек рискует приобрести врага на всю жизнь.

    У Скорпиона такой неординарный характер. Находясь рядом с ней, вы сможете насладиться вкусом переполняющей вас настоящей жизни. И, несмотря на то, что ее внешность делает ее беззащитной кошечкой, по натуре она настоящая хищница, решительная и своенравная, и ее место рядом с настоящим мужчиной.

    Где надо, она отступит, где-то не отступит ни на шаг, но всегда будет поступать так, как считает нужным.Характеристика душевных качеств женщины-Скорпиона такова, что в открытую борьбу с ней лучше не вступать, а тем более играть в психологические штудии. Она, так или иначе, победит вас в любом противостоянии, так как является очень сильной натурой с несгибаемым духовным стержнем.

    В нем отмечается множество противоречивых черт характера, но главное его качество – страстность. Причем это проявляется не только в любви, но и в быту.Ее внутренняя жизнь богата, разнообразна и напряженна, но внешне она незаметна не только для окружающих, но и для близких. Но скрыть что-либо от женщины-Скорпиона достаточно сложно. Она очень проницательна, хоть и действует исподтишка, но всегда с положительным результатом. Продолжением характеристики страстной натуры женщины-Скорпиона является ее необузданная ревность, часто безосновательная.

    В противовес ревнивой женщине-Скорпиону можно поставить свободолюбивую женщину-Водолея.

    Несмотря на кипящие в душе страсти, это довольно деловая и практичная женщина. Ей сложно найти себе равных в финансовых вопросах. Так, семейным бюджетом она управляет умело, и не допускает лишних трат. Женщина-Скорпион всегда найдет путь к сердцу мужчины, но иногда может бесцеремонно залезть в душу.

    Женщина-Скорпион, характеристика предпочтений

    Влюбленная женщина Скорпион

    Скорпион — водный знак, и кажется, что его чувства должны быть прохладными и мимолетными.Но, женщина-Скорпион брала у воды не ее прохладу, а ее глубину. В характеристике женщины-Скорпиона присутствует такая черта, как страстность. Так вот, в любви эта черта проявляется в полной мере. Она любит глубоко и страстно, но окружающие этого не видят, она не выставляет напоказ свои чувства. В сексуальном плане это самый страстный знак зодиака.
    С такой же страстью он может не доверять и ревновать. Женщине-Скорпиону лучше не вызывать ревность, она не будет спокойно смотреть на измену мужа или партнера.В своей неудержимой ревности она способна на многое, вплоть до разрыва отношений. По его Характеристика женщина-Скорпион очень влюбчивый человек. Если в ее отношениях с любимым мужчиной что-то не получается, и они по какой-то причине расстаются, она не будет вечно лить слезы и «посыпать голову пеплом». Она вполне готова к новой любви и может влюбляться неоднократно.

    Какой интерьер подойдет женщине Скорпиону

    Женщина-Скорпион – натура с сильным характером и страстными чувствами, крайне строгая к себе и окружающим.Характеристика таких ее качеств говорит о том, что она тратит много внутренней энергии, нуждается в какой-то эмоциональной помощи извне, в том числе и со стороны стен своего дома. Женщина-Скорпион любит приглушенное освещение, непрозрачные шторы и практичную мебель. В оформлении интерьера представители этого знака зодиака часто используют насыщенные цвета: красный, глубокий синий, терракотовый, изумрудно-зеленый и даже черный.

    Аромат для женщины-Скорпиона

    Характеристика основных качеств женщины-Скорпиона определяет и список ее предпочтений в ароматах.Ей нравятся духи с легким успокаивающим ароматом, они несколько снижают накал ее страстей. Она любит изысканный аромат нарцисса, ароматы цитрусовых держат женщину-Скорпиона в хорошем настроении, аромат ванили успокаивает и умиротворяет. Духи, которыми пользуется женщина-Скорпион, сочетают в себе холодные верхние ноты цитрусовых и теплые и чувственные нижние восточные ноты.

    Рекомендуемые для нее духи, наиболее полно отражающие характеристика Женщины-Скорпионы : Contradiction, Exctravagance, D’Amarige, Vanessa.Нежная, страстная и чувственная Truth от Calvin Klein – визитная карточка страстной и чувствительной натуры женщины-Скорпиона. асимметричный флакон, упакованный в коробку насыщенных красных, синих или лиловых тонов.

    Талисманы женщины-Скорпиона

    Талисманы этого знака — скорпионы, жуки, пауки, змеи, желательно в виде украшений из металла или камня. Пусть жук и жук-скарабей помогают женщине-Скорпиону в торговле и в дороге. Кроме того, малахитовый скарабей отгоняет беды, а серебряный скарабей защищает от ошибок.Одной из отличительных черт женщины-Скорпиона является ее вера в магические знаки и талисманы. Возможно, именно поэтому ее талисманы часто помогают ей в жизни. Паук в виде броши из белого металла привлечет деньги и усилит оккультные способности, если таковые имеются. На талисмане женщины-Скорпиона изображено что-то загадочное, мистическое или пейзаж дикой природы: омут, болото, горная река, водопад.

    Женщина-Скорпион и алкоголь

    Алкогольная характеристика женщины-Скорпиона не самая благоприятная.К сожалению, она любит выпить. Конечно, это не постоянная привычка, но в хорошей компании или на каком-нибудь торжестве он может расслабиться и выпить больше, чем позволяет благоразумие.

    В состоянии алкогольного опьянения, склонна к развязанным рукам и языку, часто не в состоянии контролировать свои эмоции, что не лучшим образом сказывается на личных отношениях. Поэтому неплохо бы перед любым мероприятием, где предполагается веселое застолье, женщина-Скорпион внутренне дала себе установку – ограничиться одной-двумя рюмками легкого вина.

    Скорпион-женщина-невестка

    Очень сложно ужиться с такой невесткой, как женщина-Скорпион. Она властолюбива, не терпит ничьих советов и поучений. У нее частые перепады настроения, она болезненно чувствительна. В характеристике женщины-Скорпиона много положительных качеств, но не по отношению к матери или сестрам избранника. Их отношения с ее мужчиной, считает она, еще не повод подчиняться им. Но все шероховатости в отношениях сразу исчезают, если молодые живут отдельно от старшего поколения, родители и родственники не надоедают частыми свиданиями и не учат жить невестку.

    Скорпион-свекровь женщина

    Любит делать так, чтобы другие думали: «Какая сука!». При этом женщина-Скорпион искусственно создает такие стрессовые ситуации, а потом с интересом наблюдает за реакцией окружающих. Но, насладившись негативной реакцией близких, сожалеет и начинает терзаться угрызениями совести и плавно переходит к поискам путей примирения. С такой характеристикой характера женщины-Скорпиона невестка может смириться, относясь к выходкам свекрови спокойно, с чувством юмора.

    Скорпион и Зодиак |

    Убийца Зодиак вдохновил многих вымышленных злодеев в книгах, на телевидении и в фильмах. В 1971 году в кинотеатре Сан-Франциско был показан малобюджетный фильм под названием «Убийца Зодиака » . Режиссер Том Хансен надеялся, что фильм сможет привлечь в кинотеатры настоящего убийцу Зодиака. Кинозрителей попросили ответить на вопрос: «Я считаю, что Зодиак убил, потому что…». Письменные ответы были проверены на наличие сходства с отчетливым почерком Зодиака.План не удался, хотя Том Хансен считал, что, возможно, столкнулся с настоящим убийцей Зодиака.

    Через несколько месяцев после короткого показа фильма Убийца Зодиака в Америке прокатился блокбастер, навсегда изменивший жанр боевиков. Грязный Гарри мгновенно стал хитом, послужил источником вдохновения для четырех сиквелов и укрепил образ актера Клинта Иствуда как всеамериканского героя с ружьем. Полицейский из Сан-Франциско Гарри Каллахан носил гигантский пистолет 44. Magnum и мало пользовался правилами при преследовании своей добычи.Легендарное выступление Иствуда и цитируемые шутки создали новый стандарт для звезд боевиков, повторяемых в бесчисленных подражаниях.

    Личность полицейского-линчевателя Клинта Иствуда была оправдана только в балансе экстремальным характером злодея, доведшего историю до жестокого завершения. Актер Эндрю Робинсон снялся в роли сумасшедшего убийцы, который называл себя «Скорпионом» в рукописных письмах, отправленных в газету San Francisco Chronicle.

    Как и Зодиак, Скорпион (Эндрю Робинсон) дразнил полицию по телефону.

    Кинокритик Chicago Sun Times Роджер Эберт писал, что «Скорпион изображается как самое злобное, извращенное, изуродованное чудовище, которое мы можем себе представить». Многие кинозрители не знали, что Скорпион был основан на реальном монстре, известном как Зодиакальный убийца. Сообщается, что персонаж Иствуда был частично основан на инспекторе SFPD Дэвиде Тоски, следователе, ведущем охоту на Зодиака.

    Инспектор SFPD Гарри Каллахан обнаруживает письмо, оставленное снайпером, известным как «Скорпион».

    Почерк

    Скорпиона напоминал его реальный аналог, а его письма повторяли слова Зодиака в зловещих угрозах убить невинных жертв, если власти не выполнят его требования. Как и Зодиак, Скорпион также ненавидел полицию Сан-Франциско.

    Городу Сан-Франциско. Я буду наслаждаться убийством одного человека каждый день, пока вы не заплатите мне сто тысяч долларов (100 000 долларов США). Если вы согласны, напишите об этом завтра утром в личной колонке San Francisco Chronicle, и я устрою встречу.Если я не получу от вас известия, моим следующим удовольствием будет убить католического священника… Обманщившая меня полиция Сан-Франциско заставила меня сделать это. Скорпион

    Почерк Скорпиона был похож на почерк Зодиака, а его угроза убить снова, если власти не выполнят его указания, напоминала первое письмо Зодиака с угрозой убить снова, если его письмо не будет опубликовано в San Francisco Chronicle и других газетах.

    Финальное противостояние между Каллаханом и Скорпионом также было вдохновлено печально известной угрозой Зодиака убить детей в школьном автобусе.Зодиак предупредил, что прострелит шины, а затем расстреляет детей. Скорпион угнал школьный автобус и потребовал выкуп за детей.

    Мэр и начальство полиции просят его доставить выкуп, но Гарри исчерпал свой лимит. Он намеревается положить конец террору и остановить Скорпиона любыми средствами. Гарри буквально запрыгивает в угнанный автобус и заставляет Скорпиона бежать. Убийца использует школьника как щит, но разъяренный полицейский просто стреляет Скорпиону в плечо и сбивает его с ног.Инспектор произносит свой последний монолог/броскую фразу: «Вы должны задать себе один вопрос: «Я чувствую себя счастливым?» Ну, а ты, панк?» Скорпион тянется за пистолетом, но Гарри стреляет из своего фирменного пистолета 44-го калибра и убивает маниакального психопата.

    Кровавое буйство Скорпиона

    и жестокость Каллахана разожгли споры о послании фильма и политике изображения полиции как смертоносных линчевателей. Фильм был основан на оригинальном сценарии Гарри Джулиана Финка и Риты М.Финка, но персонаж и история Каллахана менялись много раз, в то время как проект проходил через различные этапы развития с несколькими актерами, рассматриваемыми на главную роль, включая Фрэнка Синатру. Писатель Джон Милиус, называющий себя «правым экстремистом», написал черновик сценария, и его политические взгляды сформировали образ Гарри Каллахана. Милиус описал свой вклад в фильм как «много оружия. И отношение Грязного Гарри, безжалостного полицейского. Я думаю, довольно очевидно, если вы посмотрите на остальную часть моей работы, какие части принадлежат мне.Полицейский такой же, как и убийца, за исключением того, что у него есть значок». Милиус утверждал, что фильм «более важен, чем Крестный отец ». Кинокритик Джин Сискель написал, что фильм был «опасным», а Роджер Эберт прямо охарактеризовал Грязный Гарри как фашизм.

    Грязный Гарри собрал более 35 миллионов долларов в своем первом выпуске и получил всемирную известность, когда критики и протестующие были возмущены кинематографической бойней. Коммерческий успех и неоднозначность фильма 1971 года не вызвали никакой реакции со стороны убийцы Зодиака.В 1974 году в редакцию San Francisco Chronicle поступила серия подозрительных писем Зодиака. Писатель охарактеризовал блокбастер об одержимости демонами «Экзорцист » как лучшую сатирическую комедию, а также пожаловался на прославление насилия в газетной рекламе фильма «Бесплодные земли » о реальной истории серии убийств Чарльза Старквезера. Несмотря на очевидный интерес к кино, Зодиак никогда не упоминал Грязного Гарри, или Скорпиона, вымышленного убийцу, которого он вдохновил.Спустя десятилетия, по иронии судьбы, в фильме 2007 года «Зодиак» была сцена с участием инспектора SFPD Дэвида Тоски в театре Сан-Франциско во время показа фильма « Грязный Гарри».

    Реальный убийца Зодиака и фильм, который он вдохновил, теперь легенды в американской поп-культуре. Грязный Гарри стал олицетворением правосудия, совершаемого через дуло дымящегося пистолета, а убийца Скорпион прославился как один из самых запоминающихся злодеев кино. В отличие от Скорпиона, Зодиак избегал правосудия в течение пятидесяти лет, и его тень до сих пор бродит по улицам Сан-Франциско.

     

    * * *

     

    Цитата Джона Милиуса: Томпсон, Ричард (июль 1976 г.). «Заряжен». Комментарий к фильму 12.4. стр. 10–21.

    Валидация ПЦР в реальном времени для молекулярной идентификации Mycobacterium tuberculosis

    Braz J Microbiol. 2014; 45 (4): 1363–1369.

    Мариана Л. Продажи

    1 Laboratorio Nacional Agropecuário de Minas Gerais, Pedro Leopoldo MG , Бразилия, Laboratório Nacional Agropecuário de Minas Gerais, Pedro Leopoldo, MG, Бразилия.

    Антонио Аугусто Фонсека, Джуниор

    1 Laboratorio Nacional Agropecuário de Minas Gerais, Pedro Leopoldo MG , Бразилия, Laboratorio Nacional Agropecuário de Minas Gerais, MG , Бразилия, Laboratorio Nacional Agropecuário de Minas Gerais.

    Ливия Орзил

    1 Laboratorio Nacional Agropecuário de Minas Gerais, Pedro Leopoldo MG , Бразилия, Laboratório Nacional Agropecuário de Minas Gerais, Pedro Leopoldo, MG, Бразилия.

    Андреа Падилья Аленкар

    1 Laboratorio Nacional Agropecuário de Minas Gerais, Pedro Leopoldo MG , Бразилия, Laboratorio Nacional Agropecuário de Minas Gerais, Pedro Leopoldo, MG.

    Марсио Роберто Сильва

    2 EMBRAPA Гадо де Лейте, Жуиз де Фора MG , Бразилия, EMBRAPA Гадо де Лейте, Жуиз де Фора, штат Массачусетс, Бразилия.

    Marina Azevedo Issa

    1 Laboratorio Nacional Agropecuário de Minas Gerais, Pedro Leopoldo MG , Бразилия, Laboratório Nacional Agropecuário de Minas Gerais, Pedro Leopoldo, MG.

    Paulo Martins Soares Filho

    1 Laboratorio Nacional Agropecuário de Minas Gerais, Pedro Leopoldo MG , Бразилия, Laboratorio Nacional Agropecuário de Minas Gerais, Pedro Leopoldo, MG.

    Андрей Перейра Лаге

    3 Ветеринарная школа, Федеральный университет Минас-Жерайс, Белу-Оризонти MG , Бразилия, Ветеринарная школа, Федеральный университет Минас-Жерайс, Бразилия, Белу-Оризонти.

    Marcos Bryan Heinemann

    3 Ветеринарная школа, Федеральный университет Минас-Жерайс, Белу-Оризонти MG , Бразилия, Ветеринарная школа, Федеральный университет Минас-Жерайс, MG, Белу-Оризонти.

    1 Laboratorio Nacional Agropecuário de Minas Gerais, Pedro Leopoldo MG , Бразилия, Laboratorio Nacional Agropecuário de Minas Gerais, Pedro Leopoldo, MG, Бразилия.

    2 EMBRAPA Gado de Leite, Juiz de Fora MG , Бразилия, EMBRAPA Gado de Leite, Juiz de Fora, MG, Бразилия.

    3 Ветеринарная школа, Федеральный университет Минас-Жерайс, Белу-Оризонти MG , Бразилия, Ветеринарная школа, Федеральный университет Минас-Жерайс, Белу-Оризонти, MG, Бразилия.

    Отправить корреспонденцию А.А. Фонсека Джуниор. Laboratorio de Biologia Molecular, Pedro Leopoldo, MG, Бразилия. Электронная почта: [email protected]

    Поступила в редакцию 27 марта 2013 г.; Принято 17 апреля 2014 г.

    Copyright © 2014, Sociedade Brasileira de Microbiologia

    Все содержимое журнала, если не указано иное, распространяется под лицензией Creative Commons License CC BY-NC.

    Эта статья была процитирована другими статьями в PMC.

    Abstract

    Mycobacterium tuberculosis является основной причиной туберкулеза у людей.Эта бацилла приобрела известность с появлением ВИЧ, представляя собой важную оппортунистическую инфекцию, связанную с синдромом приобретенного иммунодефицита (СПИД). Настоящее исследование направлено на разработку ПЦР в реальном времени с использованием технологии Eva Green для молекулярной идентификации изолятов M.tuberculosis . Праймеры были сконструированы для гена Rv1510. Были протестированы 99 образцов M.tuberculosis и 60 образцов M.bovis , и количественная ПЦР не выявила ни одного образца бычьей бациллы.Статистические тесты не показали различий между количественной ПЦР и биохимическими тестами, используемыми для идентификации Mycobacterium tuberculosis . Корреляция между тестами была идеальной с индексом Каппа 1,0 (р < 0,001, ДИ = 0,84-1,0). Диагностическая чувствительность и специфичность составляли 100 % (ДИ = 95,94–100 %) и 100 % (ДИ = 93,98–100 %). Эта количественная ПЦР была разработана с целью диагностики бациллы M. tuberculosis в образцах бактериальной суспензии. Референс-лаборатории по ТБ (секторы здравоохранения и сельского хозяйства), программы общественного здравоохранения и эпидемиологические исследования, вероятно, могут извлечь пользу из такого метода.

    Ключевые слова: Mycobacterium tuberculosis , диагностика, ПЦР в реальном времени

    Введение

    Туберкулез (ТБ) является одним из древнейших и наиболее серьезных известных заболеваний. Исследования с использованием ДНК, выделенной из костей крупного рогатого скота, найденных в Северной Америке и датированных 17 000 г. до н.э., показали присутствие Mycobacterium tuberculosis (Rothschild et al. , 2001). Во время промышленной революции из-за скопления рабочих возникли многочисленные случаи заболевания туберкулезом (Costa, 1985).В первой половине ХХ века болезнь терроризировала Европу, и диагноз означал смертный приговор для 50% инфицированных, в основном детей и молодежи (Daniel et al. , 1984).

    Была надежда, что туберкулез будет ликвидирован к 2000 году в развитых странах. Однако с пандемией СПИДа туберкулез легких стал третьей наиболее распространенной оппортунистической инфекцией среди ВИЧ-позитивных пациентов (Job, 1998). Возникновение сочетанной инфекции ТБ с вирусом иммунодефицита человека (ВИЧ) вызвало изменение эпидемиологических тенденций в отношении ТБ, который теперь представлен как важный условно-патогенный возбудитель, связанный с синдромом приобретенного иммунодефицита (СПИД) (Carvalho, 2006).По оценкам Всемирной организации здравоохранения (ВОЗ), одна треть населения земного шара инфицирована Mycobacterium tuberculosis ; ежегодно 8 млн человек заболевают и 2,9 млн человек умирают в результате заражения туберкулезом (ВОЗ, 2013 г.). Из 8 миллионов случаев, регистрируемых ежегодно, 95% приходится на развивающиеся страны (Бразилия, 2002 г.). В прошлом туберкулез легких использовался как показатель периферического развития.

    Хотя культура микобактерий является золотым стандартом для подтверждения диагноза ТБ, этот процесс требует более трех недель для окончательного результата и не зависит от вида.Основными проблемами при идентификации микобактерий фенотипическими методами являются разнообразие необходимых биохимических тестов и время, необходимое для завершения тестов (Telenti et al. , 1993). Эти тесты могут быть трудоемкими, длительными, неточными и невоспроизводимыми, могут давать неоднозначные результаты и требовать адекватных условий с высоким уровнем биобезопасности (Huard et al. , 2003).

    Методы молекулярной биологии широко применимы для лабораторной диагностики инфекционных заболеваний, вызываемых вирусами (Fonseca Jr. и др. , 2010), бактерии (Cortez et al. , 2006), паразиты или грибы (Sotiriadou et al. , 2013). Амплификация фрагментов ДНК открыла прекрасные перспективы для обнаружения инфекционных агентов. ПЦР имеет ряд преимуществ по сравнению с традиционными методами диагностики. ПЦР отличается высокой чувствительностью, специфичностью и быстротой. Для постановки положительного диагноза требуется меньшее количество бактериальных клеток, и бактерии не обязательно должны быть жизнеспособными, что означает, что можно использовать недостаточно законсервированные образцы (Abrahão, 1999, Narayanan, 2004).ПЦР в реальном времени (qPCR) имеет дополнительные преимущества, включая точность, воспроизводимость, аккуратность, процессы контроля качества и снижение загрязнения. Кроме того, количественная ПЦР устраняет необходимость в электрофорезе после циклической реакции. Кроме того, этот метод сокращает время анализа до трех-четырех дней, что важно при трудоемкой и длительной микробиологической диагностике, например, при ТБ.

    Быстрая диагностика туберкулеза человека имеет большое клиническое значение. Существуют коммерческие методы обнаружения М.tuberculosis , но эти методы основаны на множестве зондов или обнаруживают комплекс Mycobacterium tuberculosis (MTC), но не конкретный вид (Rossau et al. , 1997). Таким образом, целью данного исследования была разработка ПЦР в реальном времени с использованием бактериальных суспензий и Eva Green ® для идентификации M. tuberculosis в качестве альтернативы фенотипическим тестам.

    Материалы и методы

    qPCR

    Олигонуклеотиды, разработанные в этом исследовании, были основаны на полной последовательности генома M.туберкулез (Cole и др. , 1998). Сначала последовательности подвергали BLAST ® (http://blast.ncbi.nlm.nih.gov/Blast.cgi) для проверки геномных различий (Altschul et al. , 1997). Затем выбранные последовательности-мишени, доступные в GenBank (NCBI, http://www.ncbi.nlm.nih.gov/), выравнивали в BioEdit (16). После проверки идеальных участков, а именно присутствующих только на M.tuberculosis , в программе Primer3Plus были сконструированы праймеры (Untergasser et al., 2007) и анализировали с помощью программы Oligo Analyzer 3.1 (IDT, США) для верификации вторичных структур. Аналитическая специфичность праймеров In silico тестировалась с помощью программы PrimerBlast (NCBI, http://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi?LINK_LOC=BlastHome) (Altschul et и др. , 1990).

    Участком, выбранным для специфического обнаружения ДНК M. tuberculosis , был ген Rv1510. Праймеры Mtub.115.F: 5’TTCGATATTCGCGGTGTTTT3′ (318446–318465, со ссылкой на {«type»:»entrez-нуклеотид»,»attrs»:{«text»:»BX842576.1″,»term_id»:»384

    «,»term_text»:»BX842576.1″}}BX842576.1) и Mtub.115.R: 5’CGCAACTATTTGGGTGGAG3′ (318542–318560) амплифицируют сегмент гена длиной 115 п.н. Идеальные реакции КПЦР содержали 10 пмоль каждого праймера (IDT, США), 1,5 ед. полимеразы GoTaq Hot Start (Promega, США), 20% бесцветного буфера GoTaq Hot Start 5x, 1,5 мМ MgCl 2 , 1 мкл 20x Eva. Green (Biotium, США), 2 мкл Rox 10x (Biotium, США), 10 мМ dNTP и 2 мкл ДНК до конечного объема 20 мкл Все тесты проводились на Rotorgene 3000 (Qiagen, Германия) по следующей программе : денатурация при 95°С в течение 3 мин, затем 35 циклов при 95°С в течение 10 с, 60°С в течение 15 с и 72°С в течение 20 с с показаниями флуоресценции.Кривая плавления была построена со следующими параметрами: 45 с при 72 °С и 3 с на градус до 99 °С. Экстракцию ДНК оценивали с помощью количественной ПЦР, нацеленной на рибосомную ДНК. Праймеры M.sp.rDNA.133.F (5’GTCCTTGGAGACGTTCCTCA3′) и M.sp.rDNA.133.R (5’CACGTCGATCACCACG TAGA3′) использовали с теми же концентрациями реагентов и условиями циклирования, которые использовались для обнаружения Rv1510.

    Образцы

    Стандарт Штаммы M.tuberculosis h47Rv CRNC 23 и h47Ra CRNC 25 использовали в качестве положительных контролей, а M.bovis AN5 Мексика CRNC 36, M . Стандартные штаммы bovis AN5 CRNC 02, M. bovis AN5 CRNC 01 и M. bovis BCG CRNC использовали в качестве отрицательного контроля для всех тестов в этом исследовании.

    Методы видообразования на основе фенотипа

    Все положительные культуры КУМ подвергали дополнительным методам видообразования по фенотипу, включая биохимические тесты, такие как каталаза при комнатной температуре и при 68 °C, ниацин, нитрат, пиразинамидаза и уреаза.Для различения штаммов микобактерий использовали тест на чувствительность к лекарственным препаратам (ТЛЧ) (Job, 1998).

    Методы молекулярного видообразования

    Две петли каждой реплики микобактерий, которые росли на средах Lowenstein Jensen или Stonebrink, переносили в микроцентрифужную пробирку, содержащую 400 мкл 1X TE-буфера, и отдельно подвергали нагреванию для уничтожения и лизиса клеток. Инактивированные изоляты хранили при температуре от 2 до 8 °C до использования в реакциях ПЦР.

    Быстрая дифференциация 99 М.tuberculosis и 60 изолятов M. bovis проводили молекулярными методами для подтверждения реального положения исследуемых образцов. M.tuberculosis образцов были ранее выделены и любезно предоставлены компанией Embrapa Gado de Leite. М . изолятов bovis были собраны на скотобойнях Lanagro/MG из тканей с поражениями, характерными для туберкулеза крупного рогатого скота, и протестированы с помощью количественной ПЦР, ранее подтвержденной нашей группой (Sales et al., 2014a, Sales et al., 2014б). ДНК микобактерий подвергали амплификации гена pncA (Scorpio and Zhang, 1996) и обнаружению полиморфизма pncA путем расщепления ампликона Eco 065I, как описано ранее (Barouni et al. , 2004) для генетической идентификации M. bovis или M. tuberculosis . Этот анализ был проведен в Лаборатории молекулярной биологии, применяемой к микобактериям, Институт Освальдо Круза, Фиокрус .

    Критерии валидации

    Параметры методологии валидации были установлены в соответствии с Руководством по диагностическим тестам и вакцинам для наземных животных (МЭБ, 2010).

    Эффективность реакции

    Эффективность реакции проверяли путем исследования 10-кратных разведений в буфере 1X TE ДНК, извлеченной из положительных контролей. Каждое разведение тестировали в двух повторностях и определяли концентрацию на спектрофотометре Nanovue ® (GE Healthcare, США).Был построен ряд стандартных кривых для определения оптимальной концентрации праймера.

    Предел обнаружения (LOD) и аналитическая специфичность

    Определение LOD проводили путем 10-кратного разведения стандартного штамма. Разведения тестировали в трех повторностях, и LOD определяли как разведение, при котором все повторы были положительными. LOD был подтвержден путем повторения количественной ПЦР двадцать один раз.

    В аналитических тестах на специфичность использовались следующие штаммы: 60 M.BOVIS Изоляты , M. fortuitum CRNC 10, M. Kansasii CRNC 48 и CRNC 18, M. Gordonae CRNC 16, M. Avium D4 CRNC 05, M. Avium Paratuberculosis CRNC 26, M. 21, М. Тривиаль CRNC 22, М.fortuitum peregrinum CRNC 11, M. phei CRNC 12, Rhodococcus equi CRC 09/01, Corynebacterium pseudotuberculosis CRC 09/02 и Nocardia asteroides CRC1 10.

    Повторяемость

    Повторяемость оценивалась с использованием семи образцов M.tuberculosis и трех образцов M.bovis . Мы выделили ДНК из семи образцов в три разных дня и подвергли извлеченную нуклеиновую кислоту количественной ПЦР. Чтобы оценить возможные изменения в тесте, второй аналитик выполнил методику, используя те же критерии и те же образцы.

    Надежность

    Мы проанализировали надежность анализа с потенциальными проблемами, которые могут возникнуть, такими как неправильная калибровка пипетки или термоциклера, чтобы оценить, как эти проблемы повлияют на диагностику туберкулеза человека. Пять образцов M. tuberculosis и пять образцов M. bovis использовали в анализе количественной ПЦР с повышенной на 1 °C температурой отжига и на 10% меньшим количеством фермента, MgCl 2 и праймеров. Вторую кПЦР проводили с пониженной на 1 °C температурой отжига и на 10% больше фермента, MgCl 2 и праймеров.

    Статистический анализ

    Мы использовали критерий Макнемара для сравнения парных пропорций, каппа-критерий для определения степени согласованности между двумя тестами для каждого образца и анализ чувствительности и специфичности (Kraemer, 1992).

    Для анализа диагностической чувствительности и диагностической специфичности использовали 99 изолятов M.tuberculosis из Бразилии. Каждый образец одновременно тестировали фенотипическим и количественным методом ПЦР. Метод количественной ПЦР сравнивали с методом видообразования на основе фенотипа в качестве золотого стандарта.

    Результаты

    qPCR

    Средняя температура плавления положительных образцов в qPCR для M. tuberculosis составила 94,11 °C со стандартным отклонением 1,31 °C. qPCR смогла обнаружить до 9,88 × 103 копий/мкл на стандартной кривой с R 2 99% и с эффективностью 78% (). Средняя температура плавления положительных образцов при количественной ПЦР для рибосомной ДНК составила 87,2 °С.

    Таблица 1

    Средние значения σ Ct и стандартные отклонения количественной ПЦР.

    +

    0,24

    0,48

    копий / мкл Концентрация (нг / мкл) Ct σ
    9,88 × 10 6 47,5 20,56 0,64
    9,88 × 10 5 4.7 24.03
    9,88 × 10 4 0,47 28,95
    9,88 × 10 3 0.047 30776

    32.64 0,41
    9.88 × 10

    9.88 × 10 2 9076

    Повторяемость и надежность

    QPCR имели аналогичные результаты при выполнении в разные дни и другой аналитик. Средняя температура плавления составила 94,72°С со стандартным отклонением 0,26°С. При использовании ДНК M. bovis амплификации обнаружено не было. Изменения порогов циклов (Ct) и температур плавления, обнаруженные в ходе испытаний на устойчивость, описаны в и .

    Таблица 2

    Изменение температуры плавления и порога цикла в тестах на надежность для количественной ПЦР.

    926


    93.63

    9078 9 93766

    Вид Образец Прочность 1 * Прочность 2


    CT таяния CT CT таяния
    M. tuberculosis 1 1295 94,4 19,44 94,1
    2 18,31 94,4 29,44 94,5
    3 16,30 94,5 26,73 94,4
    4 4 17.37 93.56 24.88 93.63 93.63
    5 19.36 9443 94.43 31.76 93,6
    М. Bovis 1 —
    2 — — —
    3
    4 — —
    5

    Denat) положительных и отрицательных образцов, используемых в надежности 1 (a) и надежности 2 (b) для qPCR-Mtub-115.

    Статистический анализ

    Тест McNemar не показал существенных различий между методами количественной ПЦР (p = 0,3173) и методами микробиологического выделения, а тест Каппа показал полное совпадение (0,98) между двумя тестами.

    Чувствительность и специфичность

    КПЦР обнаружила только ДНК, выделенную из M. tuberculosis . Все другие нуклеиновые кислоты из других Mycobacterium и других видов бактерий, протестированных в этой работе, были отрицательными во всех проведенных тестах.Диагностическая чувствительность и специфичность составили 100 % (ДИ = 95,94–100 %) и 100 % (ДИ = 93,98–100 %) соответственно.

    Обсуждение

    Фенотипические тесты, используемые для идентификации изолятов Mycobacterium , требуют много времени и ненадежны. Использование молекулярных тестов для правильной идентификации микроорганизмов является быстрым, надежным и чувствительным. КПЦР, разработанная в этом исследовании, не амплифицирует ДНК ни одного из Mycobacterium spp. кроме образцов M.tuberculosis , используемых в аналитических тестах на специфичность; положительные результаты были реализованы только для M.tuberculosis использовали в качестве положительного контроля.

    Описанные здесь тесты количественной ПЦР не обнаруживают три вида MTC: M. canettii , M. africanum 1 и M. africanum 2. Однако эти результаты не делают недействительным использование этого анализа количественной ПЦР за пределами Африки. M. africanum и M. canettii вызывают туберкулез человека, но ограничены Африкой или случаями, тесно связанными с этим континентом. Медикаментозное лечение инфекций, вызванных этими видами, такое же, как и для M.туберкулез (Frothingham et al. , 1999, van Soolingen et al. , 1997). Есть несколько случаев, связанных с M. africanum в странах, тесно связанных с Западной Африкой. В Испании, например, регистрируется более 7500 случаев туберкулеза в год, но в период с 2000 по 2010 год зарегистрировано только 57 случаев, вызванных M. africanum (Isea-Peña et al. , 2012). Мы сосредоточились на дифференциации M. tuberculosis и M. bovis .Туберкулез, вызываемый Mycobacterium bovis , возбудителем туберкулеза крупного рогатого скота, клинически неотличим от туберкулеза человека, вызываемого M. tuberculosis , и является важной причиной инфекции в развивающихся странах (Silva et al. , 2013). Это различение возможно только при использовании определенных питательных сред и последующей характеристике методами фенотипического и молекулярного видообразования. Лечение инфекции M. bovis отличается от лечения инфекции M. tuberculosis из-за естественной резистентности к пиразинамиду (Ruggiero et al., 2007).

    Эффективность количественной ПЦР составила 78%, что указывает на присутствие в реакции ингибиторов, вероятно, димеров праймеров или образования вторичных структур в ампликоне. Фактически праймеры имеют несколько повторений нуклеотидов, что увеличивает возможность неспецифических реакций. Амплифицированная область богата гуанином и цитозином (G+C = 64%), что может препятствовать как диссоциации ампликонов, так и образованию новых ампликонов за счет вторичных структур (Raso et al., 2011). Таким образом, эта количественная ПЦР не рекомендуется для количественного определения образцов; однако количество образцов, использованных в этой работе, показывает, что это надежный метод для правильной идентификации M. tuberculosis .

    Тесты на повторяемость и воспроизводимость необходимы для установления рутинной методики в лаборатории, как указано в ISO 17025 и Принципах и методах валидации диагностических тестов на инфекционные заболевания (МЭБ, 2010). Этот шаг имеет решающее значение в процессе валидации и демонстрирует, что метод может быть легко продублирован другим аналитиком и не страдает от постоянного повторения.Тесты на надежность показали, что на диагностику могут влиять несколько факторов, таких как уменьшение количества реагента и повышение температуры отжига. Увеличение количества реагента и снижение температуры отжига улучшили эффективность количественной ПЦР. Эти изменения не усиливали M. bovis , использованного в тестах на устойчивость, но могли снизить специфичность, поэтому мы решили не использовать его в нашей диагностике.

    Этот количественный ПЦР был разработан с целью диагностики бациллы M. tuberculosis в образцах бактериальной взвеси. Хотя это и не рекомендуется для количественной оценки, валидация с большим количеством положительных и отрицательных образцов показывает, что она обеспечивает повторяемость, воспроизводимость и диагностическую точность. Важно проверить ПЦР со многими образцами. В литературе имеются сообщения, показывающие неспецифические результаты обнаружения M.tuberculosis даже при использовании областей, считающихся безопасными для генетической характеристики в MTC, таких как RD9 и RD12 (Ueyama et al., 2014). Метод, утвержденный в этой работе, можно использовать в качестве альтернативы фенотипическим тестам при диагностике ТБ, поскольку это быстрый и надежный метод, использующий менее дорогой химический состав в ПЦР в реальном времени. Следует также учитывать, что M.tuberculosis является наиболее распространенным возбудителем туберкулеза человека. В дополнение к тому факту, что для проверки этих методов использовалось большое количество образцов и тестов (повторяемость, воспроизводимость и надежность), КПЦР, разработанная в этой работе, предлагает преимущества по сравнению с другими тестами ПЦР, которые основаны только на однонуклеотидных полиморфизмах (Гох). и др., 2006), требуют электрофореза в агарозных гелях (Shah et al. , 2002) или тестировались только на нескольких образцах (Bakshi et al. , 2005). Тео и др. (2013) и Ли и др. (2010) продемонстрировали важность ПЦР для правильной идентификации инфекции M. bovis БЦЖ, но использовали небольшое количество образцов и мультиплексную ПЦР на основе электрофореза в агарозных гелях. Реддингтон и др. (2011) использовалась мультиплексная ПЦР в реальном времени на основе гидролизного зонда, но, поскольку этот вид ПЦР дороже, он имеет ограниченное применение в развивающихся странах, где туберкулез более распространен.КПЦР, подтвержденная в этой работе, имеет преимущества по сравнению с указанными ПЦР-тестами, поскольку не требует электрофореза в агарозном геле для визуализации результатов, использует один из самых дешевых флуорофоров для кПЦР и способна правильно идентифицировать M. tuberculosis в менее чем через три часа после выделения бактерий. Результаты показывают, что представленная здесь количественная ПЦР может использоваться в клинических лабораториях, которые внедряют систему качества, направленную на улучшение их способности стабильно давать достоверные результаты.

    Бактериальные суспензии, предположительно содержащие M.tuberculosis , могут быть подвергнуты данной количественной ПЦР. Если амплификации не происходит, то суспензия может содержать микобактерии, отличные от M.tuberculosis . В этих случаях одни и те же бактериальные суспензии могут быть подвергнуты другим методам фенотипического или молекулярного видообразования для идентификации правильного вида. Наконец, этот метод, вероятно, принесет пользу референс-лабораториям по ТБ (в секторах здравоохранения и сельского хозяйства), программам общественного здравоохранения и эпидемиологическим исследованиям.

    Благодарности

    Мы хотели бы поблагодарить CNPq, Lanagro/MG и INCT-Pecuária. APL и MBH благодарят CNPq за стипендии.

    Ссылки

    • Abrahão RMCM. Туберкулез человека causada pelo Mycobacterium bovis : следует принимать во внимание и иметь важное значение для резервирования животных. Arch Vet Sci. 1999; 4: 5–15. [Google Scholar]
      Abrahão RMCM (1999) Tuberculose humana causada pelo Mycobacterium bovis : учтите gerais e a importância dos reservatórios animais.Arch Vet Sci 4: 5–15.
    • Альтшул С.Ф., Гиш В., Миллер В., Майерс Э.В., Липман Д.Дж. Базовый инструмент локального поиска выравнивания. Дж Мол Биол. 1990; 21: 403–410. [PubMed] [Google Scholar]
      Альтшул С.Ф., Гиш В., Миллер В., Майерс Э.В., Липман Д.Дж. (1990) Базовый инструмент локального поиска выравнивания. Дж. Мол. Биол. 21:403–410. [PubMed]
    • Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. Gapped BLAST и PSI-BLAST: новое поколение программ поиска белковых баз данных. Нуклеиновые Кислоты Res. 1997; 25:3389–3402.[Бесплатная статья PMC] [PubMed] [Google Scholar]
      Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ (1997) Gapped BLAST и PSI-BLAST: новое поколение поиска в базе данных белков программы. Рез. нуклеиновых кислот 25:3389–3402. [Бесплатная статья PMC] [PubMed]
    • Barouni AS, Augusto CJ, Lopes MT, Zanini MS, Salas CE. Полиморфизм pncA для дифференциации Mycobacterium bovis и Mycobacterium tuberculosis . Молекулярные зонды. 2004; 18: 167–170.[PubMed] [Google Scholar]
      Barouni AS, Augusto CJ, Lopes MT, Zanini MS, Salas CE (2004) Полиморфизм pncA для дифференциации между Mycobacterium bovis и Mycobacterium tuberculosis . Зонды Mol Cell 18: 167–170. [PubMed]
    • Бразилия . Vigilância epidemiológica de doenças e agravos específicos: туберкулез. Министриу да Сауде; Рио-де-Жанейро: 1999. Fundação Nacional de Saúde. [Google Scholar]
      Бразилия (1999) Fundação Nacional de Saúde. Vigilância epidemiológica de doenças e agravos específicos: туберкулез.Министриу да Сауде. Рио де Жанейро.
    • Бразилия — Министерство Сауде. Manual Técnico para o Controle da Tuberculose: Cadernos de Atenção Básica. Министриу да Сауде; Бразилиа: 2002. с. 16. [Google Scholar]
      Brasil — Ministério da Saúde (2002) Manual Técnico para o Controle da Tuberculose: Cadernos de Atenção Básica. Ministério da Saúde, Brasília, 16 pp.
    • Campos R, Pianta C. Tuberculose: histórico, epidemiologia e immunologia, de 1990 a 1999, e co-infecção TB/HIV, de 1998 a 1999, Rio Grande do Sul — Brasil.Бол Сауде. 2001; 15: 61–71. [Google Scholar]
      Campos R, Pianta C (2001) Туберкулез: история, эпидемиология и иммунология, 1990–1999 гг., коинфекция ТБ/ВИЧ, 1998–1999 гг., Риу-Гранди-ду-Сул, Бразилия. Бол Сауде 15: 61–71.
    • Карвалью ЛГМ. Коинфекция Mycobacterium tuberculosis и вирус иммунодефицита человека: эпидемиологический анализ в Таубате — SP. J Брас Пневмол. 2006; 32: 424–429. [PubMed] [Google Scholar]
      Carvalho LGM (2006) Co-infecção por Mycobacterium tuberculosis e вирус иммунодефицита человека: эпидемиологический анализ в Taubaté — SP.Дж. Брас Пневмол 32: 424–429.
    • Коул С.Т., Брош Р., Паркхилл Дж., Гарнье Т., Черчер С., Харрис Д., Гордон С.В., Эйглмайер К., Гас С., Барри С.Е., Текайя Ф., Бэдкок К., Бэшем Д., Браун Д., Чиллингворт Т., Коннор Р., Дэвис Р., Девлин К., Фелтвелл Т., Джентлз С., Хэмлин Н., Холройд С., Хорнсби Т., Джагелс К., Крог А., Маклин Дж., Мул С., Мерфи Л., Оливер К., Осборн Дж., Куэйл М.А., Раджандрим М.А., Роджерс Дж. , Раттер С., Сигер К., Скелтон Дж., Скверс Р., Скверс С., Салстон Дж. Э., Тейлор К., Уайтхед С., Баррелл Б. Г. Расшифровка биологии Mycobacterium tuberculosis из полной последовательности генома.Природа. 1998; 393: 537–544. [PubMed] [Google Scholar]
      Cole ST, Brosch R, Parkhill J, Garnier T, Churcher C, Harris D, Gordon SV, Eiglmeier K, Gas S, Barry CE, Tekaia F, Badcock K, Basham D, Brown D, Чиллингворт Т., Коннор Р., Дэвис Р., Девлин К., Фелтуэлл Т., Джентлс С., Хэмлин Н., Холройд С., Хорнсби Т., Джагелс К., Крог А., Маклин Дж., Мул С., Мерфи Л., Оливер К., Осборн Дж., Куэйл М.А. , Rajandream MA, Rogers J, Rutter S, Seeger K, Skelton J, Squares R, Squares S, Sulston JE, Taylor K, Whitehead S, Barrell BG (1998) Расшифровка биологии Mycobacterium tuberculosis из полной последовательности генома.Природа 393: 537–544. [PubMed]
    • Коста, округ Колумбия. Учтите, что у вас есть тенденция к туберкулезу в Бразилии. Cad Saúde Pública. 1985; 1: 313–326. [Google Scholar]
      Коста, округ Колумбия (1985 г.) Учитывайте тенденцию к туберкулезу в Бразилии. Cad Saúde Pública 1: 313–326.
    • Кортес А., Кастро AMMG, Хайнеманн М.Б., Соареш Р.М., Лейте Р.С., Скарчелли Э., Дженовез М.Е., Альфиери А.А., Рихценхайн Л.Дж. Detecção de ácidos nucléicos de Brucella spp., Leptospira spp., герпесвирус крупного рогатого скота и вирус диареи крупного рогатого скота, em fetos bovinos abortados e em animais mortos без перинатального периода.Arq Bras Med Vet Zootec. 2006; 58: 1226–1228. [Google Scholar]
      Cortez A, Castro AMMG, Heinemann MB, Soares RM, Leite RC, Scarcelli E, Genovez ME, Alfieri AA, Richtzenhain LJ (2006) Detecção de ácidos nucléicos de Brucella spp., Leptospira spp. герпесвирус крупного рогатого скота и вирус диареи крупного рогатого скота, em fetos bovinos abortados и em animais mortos без перинатального периода. Arq Bras Med Vet Zootec 58: 1226–1228.
    • Дэниел Т.М., Бейтс Дж. Х., Даунс К.А. История туберкулеза. В: Блум Б.Р., редактор.Туберкулез: патогенез, профилактика и борьба. Ам Сок Микробиол; Вашингтон, округ Колумбия: 1994. [Google Scholar]
      Daniel TM, Bates JH, Downes KA (1994) История туберкулеза. В: Туберкулез: патогенез, профилактика и борьба. Б.Р. Блум (редактор) Am Soc Microbiol, Вашингтон, округ Колумбия.
    • Дростен С., Пэннинг М., Крамме С. Обнаружение Mycobacterium tuberculosis с помощью ПЦР в реальном времени с использованием пан-микобактериальных праймеров и пары зондов с резонансным переносом энергии флуоресценции, специфичных для M.Туберкулезный комплекс . Клин Хим. 2003; 49: 1659–1661. [PubMed] [Google Scholar]
      Drosten C, Panning M, Kramme S (2003) Обнаружение Mycobacterium tuberculosis с помощью ПЦР в реальном времени с использованием пан-микобактериальных праймеров и пары зондов переноса энергии резонанса флуоресценции, специфичных для M. Туберкулезный комплекс . Клин Хим 49: 1659–1661. [PubMed]
    • Fonseca AA, Jr, Carmagos MF, D’Ambros RMF, Braga AC, Ciacci-Zanella J, Heinemann MB, Leite RC, Reis JKP. Диагностика и генотипирование вируса псевдовозбудителя с помощью вложенной ПЦР и рестрикционный ферментативный анализ.Сьенсия Сельская. 2010;40:921–927. [Google Scholar]
      Fonseca Jr AA, Carmagos MF, D’Ambros RMF, Braga AC, Ciacci-Zanella J, Heinemann MB, Leite RC, Reis JKP (2010). ферментативные ограничения. Ciência Rural 40: 921–927.
    • Фротингем Р., Стрикленд П.Л., Бретцель Г., Рамасвами С., Массер Дж.М., Уильямс Д.Л. Фенотипическая и генотипическая характеристика изолятов Mycobacterium africanum из Западной Африки. Дж. Клин Микробиол.1999; 37: 1921–1926. [Бесплатная статья PMC] [PubMed] [Google Scholar]
      Frothingham R, Strickland PL, Bretzel G, Ramaswamy S, Musser JM, Williams DL (1999) Фенотипическая и генотипическая характеристика изолятов Mycobacterium africanum из Западной Африки. Дж. Клин Микробиол 37: 1921–1926. [Бесплатная статья PMC] [PubMed]
    • Hall TA. BioEdit: удобный редактор выравнивания биологических последовательностей и программа анализа для Windows 95/98/NT. Nucl Acids Symp Ser. 1999;41:95–98. [Google Scholar]
      Hall TA (1999) BioEdit: удобный редактор выравнивания биологических последовательностей и программа анализа для Windows 95/98/NT.Nucl Acids Symp Ser 41:95–98.
    • Huard RC, Lazzarini LC, Butler WR, van Soolingen D, Ho JL. Метод ПЦР для дифференциации подвидов комплекса Mycobacterium tuberculosis на основе геномных делеций. Дж. Клин Микробиол. 2003;41:1637–1650. [Бесплатная статья PMC] [PubMed] [Google Scholar]
      Huard RC, Lazzarini LC, Butler WR, van Soolingen D Ho JL (2003) Метод ПЦР для дифференциации подвидов комплекса Mycobacterium tuberculosis на основе геномного удаления.Дж. Клин Микробиол 41:1637–1650. [Бесплатная статья PMC] [PubMed]
    • Isea-Peña MC, Brezmes-Valdivieso MF, González-Velasco MC, Lezcano-Carrera MA, López-Urrutia-Lorente L, Martin-Casabona N, Monforte-Cirac ML, Palacios JJ, Пенедо-Палларес А., Рамирес-Росалес А., Санчес-Силос Р., Тортола-Фернандес Т., Виньюэлас-Байон Дж., Витория-Агреда А. Ред де Лабораториос де Микробиология Сервисио де Салуд дель Принципадо де Астуриас (SESPA), Эстебан Х. Микоба